Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20329
Trapped Gene
Mgrn1 (ENSMUSG00000022517)
Vector Insertion
Chr 16: 4907367 - 4907487
Public Clones CMHD-GT_422C11-3 (cmhd)
Private Clones OST367103 (lexicon) OST358829 (lexicon) OST183331 (lexicon) OST178348 (lexicon)
OST105407 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000622258 (Chr16:4907365..4907486 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTGACACTCCCCATCCTG Chr16:4907408..4907427 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000622258 (Chr16:4907365..4907486 +)
Downstram Exon
ENSMUSE00000622256 (Chr16:4907368..4907486 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTGACACTCCCCATCCTG Chr16:4907408..4907427 59.78 50 CAGGATGGGGAGTGTCAAAT Chr16:4907430..4907449 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622259 Chr16:4886317..4886473 GGCGTAGAGGACATCGACAT Chr16:4886416..4886435 60.1 55
upstream ENSMUSE00000622258 Chr16:4907365..4907486 ATTTGACACTCCCCATCCTG Chr16:4907408..4907427 59.78 50

*** Putative Vector Insertion (Chr 16: 4907367 - 4907487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000622256 Chr16:4907368..4907486 CAGGATGGGGAGTGTCAAAT Chr16:4907430..4907449 59.78 50
downstream ENSMUSE00000127772 Chr16:4910720..4910808 CTCACAAGCCGGAGAGAGTC Chr16:4910811..4910830 60.13 60
downstream ENSMUSE00000127776 Chr16:4911322..4911468 CTCCTCTACCGCCTGACAAT Chr16:4911451..4911470 59.31 55
downstream ENSMUSE00000127775 Chr16:4913690..4913807 CTGGCTAACGCCTCTCTTGT Chr16:4913756..4913775 59.64 55
downstream ENSMUSE00000127766 Chr16:4915753..4915819 CGGTCCAGGTCAAAGTTCAG Chr16:4915775..4915794 60.68 55
downstream ENSMUSE00000127777 Chr16:4916105..4916154 No primer for this exon
downstream ENSMUSE00000127765 Chr16:4918866..4918913 TCTGCTTTAATGGCTTCACG Chr16:4918908..4918927 59.06 45
downstream ENSMUSE00000127764 Chr16:4920313..4920381 TTCTTGTTCTCGATGCCGTA Chr16:4920368..4920387 59.42 45
downstream ENSMUSE00000127773 Chr16:4922594..4922753 GTCTGACAGGCACACCACAC Chr16:4922653..4922672 60.22 60
downstream ENSMUSE00000430591 Chr16:4924423..4924532 CAAGACAGGGCTGAAGGAGA Chr16:4924505..4924524 60.52 55
downstream ENSMUSE00000430573 Chr16:4926309..4926374 CAGGGTGCGACTTTGATTTT Chr16:4926342..4926361 60.11 45
downstream ENSMUSE00000127768 Chr16:4927675..4927901 GTCCGAGATGCCTGAGTAGG Chr16:4927809..4927828 59.83 60
downstream ENSMUSE00000127767 Chr16:4930691..4930814 TGAGAGCTTCTCCTCGTCCT Chr16:4930748..4930767 59.28 55
downstream ENSMUSE00000127771 Chr16:4931113..4931155 GCTTTAGGGACGGCTCATCT Chr16:4931155..4931174 60.73 55
downstream ENSMUSE00000127779 Chr16:4932200..4932298 No primer for this exon
downstream ENSMUSE00000127778 Chr16:4934195..4934239 CAACAGAGCACGACTCAGGA Chr16:4934224..4934243 60.18 55
downstream ENSMUSE00000564234 Chr16:4936896..4938292 CAGGGCAGTTCCTTAAGCTG Chr16:4937941..4937960 60.01 55
downstream ENSMUSE00000622257 Chr16:4936896..4938292 CAGGGCAGTTCCTTAAGCTG Chr16:4937941..4937960 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATTTGACACCGTGACTGG Chr16:4907407..4907427 58.47 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022517