Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20333
Trapped Gene
Nptn (ENSMUSG00000032336)
Vector Insertion
Chr 9: 58499140 - 58499665
Public Clones not available
Private Clones OST367037 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513121 (Chr9:58499065..58499139 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAAACTTGCGCCAGAGAAA Chr9:58499096..58499115 60 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513121 (Chr9:58499065..58499139 +)
Downstram Exon
ENSMUSE00000707045 (Chr9:58499666..58500676 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAAACTTGCGCCAGAGAAA Chr9:58499096..58499115 60 40 GTACCGCATGAGAACCCAGT Chr9:58500583..58500602 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000507475 Chr9:58430197..58430333 TCTCGCTCTTGCTGGTCTCT Chr9:58430277..58430296 60.43 55
upstream ENSMUSE00000707048 Chr9:58430214..58430333 TCTCGCTCTTGCTGGTCTCT Chr9:58430277..58430296 60.43 55
upstream ENSMUSE00000584306 Chr9:58466470..58466817 AGAATAACCCGGCTCACCTT Chr9:58466682..58466701 59.96 50
upstream ENSMUSE00000253189 Chr9:58471494..58471662 AACTCACTGCCACCCGTAAG Chr9:58471620..58471639 60.17 55
upstream ENSMUSE00000253174 Chr9:58475641..58475735 GAGGATTCAGGCGAATACCA Chr9:58475660..58475679 60.04 50
upstream ENSMUSE00000698206 Chr9:58477038..58477062 No primer for this exon
upstream ENSMUSE00000472506 Chr9:58488476..58488609 ATATGGCGCAAGAAGGAGAA Chr9:58488577..58488596 59.81 45
upstream ENSMUSE00000511494 Chr9:58491336..58491609 GCTCTGGTCGCTTCTTCATC Chr9:58491349..58491368 60.1 55
upstream ENSMUSE00000698207 Chr9:58492268..58492277 No primer for this exon
upstream ENSMUSE00000512433 Chr9:58498304..58498325 No primer for this exon
upstream ENSMUSE00000513121 Chr9:58499065..58499139 AAAAACTTGCGCCAGAGAAA Chr9:58499096..58499115 60 40
upstream ENSMUSE00000709977 Chr9:58499065..58499125 AAAAACTTGCGCCAGAGAAA Chr9:58499096..58499115 60 40
upstream ENSMUSE00000714674 Chr9:58499065..58499125 AAAAACTTGCGCCAGAGAAA Chr9:58499096..58499115 60 40

*** Putative Vector Insertion (Chr 9: 58499140 - 58499665) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506268 Chr9:58499666..58500685 GTACCGCATGAGAACCCAGT Chr9:58500583..58500602 60 55
downstream ENSMUSE00000707045 Chr9:58499666..58500676 GTACCGCATGAGAACCCAGT Chr9:58500583..58500602 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAACTTGCGCCAGAGAAAC Chr9:58499098..58499118 59.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATGAACTGTGCGTGACTGG Chr9:58499180..58499200 59.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032336