Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20352
Trapped Gene
Ints3 (ENSMUSG00000027933)
Vector Insertion
Chr 3: 90196028 - 90196133
Public Clones not available
Private Clones OST366171 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000304160 (Chr3:90196134..90196290 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCGAAGTCGAAAGAATGC Chr3:90196183..90196202 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000304160 (Chr3:90196134..90196290 -)
Downstram Exon
ENSMUSE00000395515 (Chr3:90195310..90196027 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCGAAGTCGAAAGAATGC Chr3:90196183..90196202 59.96 50 TAATGACCACCGTCCACAGA Chr3:90195593..90195612 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457149 Chr3:90236726..90237558 TTGTTCCTCTTGCTCCTCGT Chr3:90236955..90236974 59.99 50
upstream ENSMUSE00000457133 Chr3:90227926..90228009 AGGTTGGAAAGGTGCATGAG Chr3:90227990..90228009 60.11 50
upstream ENSMUSE00000457126 Chr3:90225658..90225741 No primer for this exon
upstream ENSMUSE00000457121 Chr3:90219415..90219528 GGACTTGGCTCTGGTGAGTC Chr3:90219501..90219520 59.84 60
upstream ENSMUSE00000457119 Chr3:90219080..90219164 GAGTGGAGTTCTGGGAGCTG Chr3:90219116..90219135 59.99 60
upstream ENSMUSE00000457114 Chr3:90217452..90217518 GGATATCCTGACGGAGCAGA Chr3:90217453..90217472 60.18 55
upstream ENSMUSE00000457109 Chr3:90215123..90215267 TTCGGCAGAAGGAAGTTGAC Chr3:90215150..90215169 60.38 50
upstream ENSMUSE00000457105 Chr3:90213920..90214049 CAGGCCTTGAGTCCTCAGTT Chr3:90213925..90213944 59.45 55
upstream ENSMUSE00000457100 Chr3:90212424..90212521 CATGGAAACGAAGCTCCTCT Chr3:90212438..90212457 59.43 50
upstream ENSMUSE00000457096 Chr3:90210096..90210287 CGCTGTGACCTCATTCGATA Chr3:90210190..90210209 59.82 50
upstream ENSMUSE00000304132 Chr3:90208436..90208523 GCTGTTCTTCAGCCCAGAAA Chr3:90208457..90208476 60.52 50
upstream ENSMUSE00000304126 Chr3:90207907..90207986 CTGGTCATGCATCACTCCAT Chr3:90207956..90207975 59.51 50
upstream ENSMUSE00000304120 Chr3:90207428..90207519 No primer for this exon
upstream ENSMUSE00000304115 Chr3:90207001..90207107 TAAAGAGCTTCGGTCCATGC Chr3:90207052..90207071 60.35 50
upstream ENSMUSE00000174429 Chr3:90206230..90206349 TGGAAATGGACAACCACCTC Chr3:90206306..90206325 60.76 50
upstream ENSMUSE00000174433 Chr3:90205765..90205894 AAGGAGACTGTCGTGGAGGA Chr3:90205843..90205862 59.83 55
upstream ENSMUSE00000174430 Chr3:90205327..90205381 AGAGGCCCAGTGTGAGGTTA Chr3:90205356..90205375 59.72 55
upstream ENSMUSE00000174432 Chr3:90204990..90205093 TGACTCGGAGCAACTGTCTG Chr3:90205066..90205085 60.18 55
upstream ENSMUSE00000174427 Chr3:90204517..90204561 TCCCTGGAGGAGTCAGTAGG Chr3:90204541..90204560 59.25 60
upstream ENSMUSE00000174438 Chr3:90204226..90204345 ATCGGCTACCACCTGCTCTA Chr3:90204241..90204260 59.86 55
upstream ENSMUSE00000174434 Chr3:90200300..90200453 ATGATGTGCGACTGCTATGC Chr3:90200327..90200346 59.86 50
upstream ENSMUSE00000174441 Chr3:90199060..90199128 GCTGCTGAACATGATTGTGG Chr3:90199080..90199099 60.27 50
upstream ENSMUSE00000174436 Chr3:90198245..90198320 ACCTGGTCATGTTTCGGAAG Chr3:90198267..90198286 59.97 50
upstream ENSMUSE00000174443 Chr3:90197996..90198109 CTGGGAAACGTTTGAGCAGT Chr3:90198077..90198096 60.29 50
upstream ENSMUSE00000174442 Chr3:90197668..90197716 CCTGCTTCAGCTACGGAGAG Chr3:90197672..90197691 60.29 60
upstream ENSMUSE00000174437 Chr3:90197018..90197185 GACCAGTTCACCACCAGCAT Chr3:90197114..90197133 61 55
upstream ENSMUSE00000304170 Chr3:90196713..90196813 AAGGCTCAACCTAGCCAACA Chr3:90196725..90196744 59.88 50
upstream ENSMUSE00000174431 Chr3:90196450..90196522 GCTGTGACGAAGCTCACAAG Chr3:90196455..90196474 59.78 55
upstream ENSMUSE00000304160 Chr3:90196134..90196290 CCTCGAAGTCGAAAGAATGC Chr3:90196183..90196202 59.96 50

*** Putative Vector Insertion (Chr 3: 90196028 - 90196133) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490758 Chr3:90195915..90196027 TTCGTTTTCGTTTGGTAGGC Chr3:90195963..90195982 60.11 45
downstream ENSMUSE00000395515 Chr3:90195310..90196027 TAATGACCACCGTCCACAGA Chr3:90195593..90195612 59.96 50
downstream ENSMUSE00000488281 Chr3:90195310..90195833 TAATGACCACCGTCCACAGA Chr3:90195593..90195612 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGAGGAGTCAGGCTCCAG Chr3:90196142..90196162 59.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAGGAGTCAGGCTCCAG Chr3:90196142..90196162 59.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027933