Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20379
Trapped Gene
Oxr1 (ENSMUSG00000022307)
Vector Insertion
Chr 15: 41683074 - 41684867
Public Clones not available
Private Clones OST365125 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000649483 (Chr15:41682921..41683073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGACACTCCGGTGCTGATG Chr15:41683030..41683049 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000649483 (Chr15:41682921..41683073 +)
Downstram Exon
ENSMUSE00000649482 (Chr15:41684868..41684963 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGACACTCCGGTGCTGATG Chr15:41683030..41683049 59.85 55 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683442 Chr15:41279047..41279135 No primer for this exon
upstream ENSMUSE00000624065 Chr15:41367116..41367273 GTGGTTCTGCCTGTTCCAAG Chr15:41367141..41367160 60.69 55
upstream ENSMUSE00000624064 Chr15:41485011..41485207 CCCCATCATCGAAGAAGAAC Chr15:41485119..41485138 59.48 50
upstream ENSMUSE00000350104 Chr15:41621069..41621164 TGCTAGGGCTGGTGTCCTAA Chr15:41621082..41621101 60.79 55
upstream ENSMUSE00000683455 Chr15:41628977..41628991 No primer for this exon
upstream ENSMUSE00000683441 Chr15:41629020..41629102 TGGGAGAAGGATGTCTTTTCA Chr15:41629054..41629074 59.66 42.86
upstream ENSMUSE00000649491 Chr15:41629022..41629102 TTCAGAAGCCTAAAGGAACCA Chr15:41629071..41629091 58.96 42.86
upstream ENSMUSE00000624062 Chr15:41632017..41632124 No primer for this exon
upstream ENSMUSE00000624061 Chr15:41633128..41633241 GTCATCCGAGGCTGAATTTG Chr15:41633211..41633230 60.6 50
upstream ENSMUSE00000624060 Chr15:41645120..41645272 GCCTGCGAGAGTTGTGTCTT Chr15:41645179..41645198 60.6 55
upstream ENSMUSE00000624059 Chr15:41648628..41648812 TTGTGAGGAATACGGCATCA Chr15:41648714..41648733 60.07 45
upstream ENSMUSE00000711367 Chr15:41651385..41652124 GTTCCTGACCGCACTAGCTC Chr15:41651689..41651708 60.02 60
upstream ENSMUSE00000722306 Chr15:41651385..41652124 GTTCCTGACCGCACTAGCTC Chr15:41651689..41651708 60.02 60
upstream ENSMUSE00000649489 Chr15:41654873..41655041 AAGCAAGTGCTACGATGCAA Chr15:41654966..41654985 59.64 45
upstream ENSMUSE00000649505 Chr15:41654873..41655041 AAGCAAGTGCTACGATGCAA Chr15:41654966..41654985 59.64 45
upstream ENSMUSE00000649488 Chr15:41657436..41657598 TGCCTTCTTCATTCAGTGGA Chr15:41657451..41657470 59.37 45
upstream ENSMUSE00000649530 Chr15:41657436..41657598 TGCCTTCTTCATTCAGTGGA Chr15:41657451..41657470 59.37 45
upstream ENSMUSE00000125412 Chr15:41680216..41680296 CTGAAGAACTGCGCACACTC Chr15:41680262..41680281 59.78 55
upstream ENSMUSE00000683447 Chr15:41680216..41680296 CTGAAGAACTGCGCACACTC Chr15:41680262..41680281 59.78 55
upstream ENSMUSE00000649485 Chr15:41682005..41682130 CCTGAATCTTTCCGACCAAA Chr15:41682065..41682084 60.04 45
upstream ENSMUSE00000649528 Chr15:41682005..41682130 CCTGAATCTTTCCGACCAAA Chr15:41682065..41682084 60.04 45
upstream ENSMUSE00000649483 Chr15:41682921..41683073 TAGACACTCCGGTGCTGATG Chr15:41683030..41683049 59.85 55
upstream ENSMUSE00000649526 Chr15:41682921..41683073 TAGACACTCCGGTGCTGATG Chr15:41683030..41683049 59.85 55

*** Putative Vector Insertion (Chr 15: 41683074 - 41684867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000649482 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649525 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649480 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649523 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649479 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649500 Chr15:41690704..41692594 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649522 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGACACTCCGGTGCTGATG Chr15:41683031..41683051 59.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGACACTCCGGTGCTGATG Chr15:41683031..41683051 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022307