Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20382
Trapped Gene
Zc3h10 (ENSMUSG00000039810)
Vector Insertion
Chr 10: 127983948 - 127984749
Public Clones not available
Private Clones OST364997 (lexicon) OST148451 (lexicon) OST77932 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371052 (Chr10:127984750..127984793 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371052 (Chr10:127984750..127984793 -)
Downstram Exon
ENSMUSE00000268134 (Chr10:127983884..127983947 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTCCACCTCCACATCACTG Chr10:127983899..127983918 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371052 Chr10:127984750..127984793 No primer for this exon

*** Putative Vector Insertion (Chr 10: 127983948 - 127984749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268134 Chr10:127983884..127983947 TCTCCACCTCCACATCACTG Chr10:127983899..127983918 59.66 55
downstream ENSMUSE00000369664 Chr10:127980652..127982594 TGCTGGAATCTGTGCTGTTC Chr10:127980863..127980882 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGGAGTTAATCGCCTTG Chr10:127984687..127984707 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAGTCGTGACTGGGAAA Chr10:127984685..127984705 60.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039810