Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20391
Trapped Gene
Rab12 (ENSMUSG00000023460)
Vector Insertion
Chr 17: 66855434 - 66868687
Public Clones (sanger) D110G09 (ggtc) IST14940F5 (tigm)
Private Clones OST364699 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000460119 (Chr17:66868688..66869054 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAGCTGCAGGTCATCATC Chr17:66868773..66868792 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000460119 (Chr17:66868688..66869054 -)
Downstram Exon
ENSMUSE00000540656 (Chr17:66855373..66855433 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAGCTGCAGGTCATCATC Chr17:66868773..66868792 59.95 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460119 Chr17:66868688..66869054 TCAAGCTGCAGGTCATCATC Chr17:66868773..66868792 59.95 50

*** Putative Vector Insertion (Chr 17: 66855434 - 66868687) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540656 Chr17:66855373..66855433 No primer for this exon
downstream ENSMUSE00000277617 Chr17:66849650..66849788 TCGAACGTCTCCTTCTTGGT Chr17:66849662..66849681 59.84 50
downstream ENSMUSE00000134728 Chr17:66847359..66847448 TCCTTGCTGCCTTGAGATTT Chr17:66847343..66847362 59.96 45
downstream ENSMUSE00000277563 Chr17:66846684..66846788 TGAAATTGTCCTTGGCACTG Chr17:66846709..66846728 59.69 45
downstream ENSMUSE00000460061 Chr17:66843852..66845143 ACAGAACGTTTCCCCCTTCT Chr17:66844955..66844974 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCTGTGCCAGATTTTTC Chr17:66856705..66856725 59 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCTCTTGTCATTCCTGCAC Chr17:66856635..66856655 61.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAAGGTTAATCGCCTTGCAG Chr17:66856990..66857010 59.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGTAGACTTTGGGAAGCAG Chr17:66857014..66857035 58.99 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023460