Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2041
Trapped Gene
Brca1 (ENSMUSG00000017146)
Vector Insertion
Chr 11: 101392409 - 101393333
Public Clones AY0425 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000113045 (Chr11:101393334..101393473 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000113045 (Chr11:101393334..101393473 -)
Downstram Exon
ENSMUSE00000113044 (Chr11:101392306..101392408 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333507 Chr11:101413083..101413126 No primer for this exon
upstream ENSMUSE00000389811 Chr11:101410329..101410427 No primer for this exon
upstream ENSMUSE00000672474 Chr11:101410329..101410434 No primer for this exon
upstream ENSMUSE00000113036 Chr11:101401295..101401348 No primer for this exon
upstream ENSMUSE00000113047 Chr11:101396842..101396919 No primer for this exon
upstream ENSMUSE00000113052 Chr11:101395253..101395341 No primer for this exon
upstream ENSMUSE00000113045 Chr11:101393334..101393473 No primer for this exon

*** Putative Vector Insertion (Chr 11: 101392409 - 101393333) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113044 Chr11:101392306..101392408 No primer for this exon
downstream ENSMUSE00000113039 Chr11:101391105..101391150 No primer for this exon
downstream ENSMUSE00000113037 Chr11:101389315..101389391 No primer for this exon
downstream ENSMUSE00000113042 Chr11:101384639..101387953 No primer for this exon
downstream ENSMUSE00000113048 Chr11:101383746..101383816 No primer for this exon
downstream ENSMUSE00000113043 Chr11:101378585..101378756 No primer for this exon
downstream ENSMUSE00000113040 Chr11:101374034..101374163 No primer for this exon
downstream ENSMUSE00000113046 Chr11:101371235..101371413 No primer for this exon
downstream ENSMUSE00000240223 Chr11:101369264..101369544 No primer for this exon
downstream ENSMUSE00000113055 Chr11:101366631..101366718 No primer for this exon
downstream ENSMUSE00000113054 Chr11:101363795..101363872 No primer for this exon
downstream ENSMUSE00000113049 Chr11:101363306..101363346 No primer for this exon
downstream ENSMUSE00000113033 Chr11:101359248..101359328 No primer for this exon
downstream ENSMUSE00000113053 Chr11:101354866..101354920 No primer for this exon
downstream ENSMUSE00000113035 Chr11:101353495..101353568 No primer for this exon
downstream ENSMUSE00000113051 Chr11:101353173..101353233 No primer for this exon
downstream ENSMUSE00000585847 Chr11:101350881..101351226 No primer for this exon
downstream ENSMUSE00000672450 Chr11:101350078..101351226 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAAATGCCACCTTGGTA Chr11:101393329..101393349 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGAAATGCCACCTTGGTA Chr11:101393329..101393349 60.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017146