Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20438
Trapped Gene
Bptf (ENSMUSG00000040481)
Vector Insertion
Chr 11: 106894396 - 106897154
Public Clones not available
Private Clones OST362759 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671040 (Chr11:106894397..106897153 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAACGGCGGTAAGGCTTTT Chr11:106894606..106894625 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671040 (Chr11:106894397..106897153 -)
Downstram Exon
ENSMUSE00000671069 (Chr11:106894397..106897153 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAACGGCGGTAAGGCTTTT Chr11:106894606..106894625 59.99 45 AAAAGCCTTACCGCCGTTAT Chr11:106894584..106894603 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486355 Chr11:106992588..106993441 GATGACCACGAGAGTGACGA Chr11:106992809..106992828 59.83 55
upstream ENSMUSE00000714292 Chr11:106992588..106993441 GATGACCACGAGAGTGACGA Chr11:106992809..106992828 59.83 55
upstream ENSMUSE00000108627 Chr11:106972127..106972949 AGGTTGTCCCCTTTTTGCTT Chr11:106972763..106972782 59.98 45
upstream ENSMUSE00000108626 Chr11:106960880..106961103 GGAAGACCTGACCAACAAGG Chr11:106960919..106960938 59.55 55
upstream ENSMUSE00000108629 Chr11:106957030..106957239 AGCTCCAAGGATGCTGAGAA Chr11:106957119..106957138 60.1 50
upstream ENSMUSE00000576188 Chr11:106956316..106956504 TTGGCGACAACACAACAAAT Chr11:106956440..106956459 60.01 40
upstream ENSMUSE00000671086 Chr11:106948026..106948211 TAGTGCTACCACTGCCTCCA Chr11:106948158..106948177 59.47 55
upstream ENSMUSE00000108620 Chr11:106943827..106944014 TGGGTCCACTCGTATCATCA Chr11:106943928..106943947 59.92 50
upstream ENSMUSE00000364449 Chr11:106942530..106942885 ACGGGTCCAAAGTCCTTACC Chr11:106942613..106942632 60.22 55
upstream ENSMUSE00000396339 Chr11:106942037..106942168 GATCAAGGCCGTTCAGATGT Chr11:106942140..106942159 60.08 50
upstream ENSMUSE00000711588 Chr11:106939834..106939963 CATTTCCAGTGAAGCACCAG Chr11:106939834..106939853 59.29 50
upstream ENSMUSE00000712453 Chr11:106939834..106939963 CATTTCCAGTGAAGCACCAG Chr11:106939834..106939853 59.29 50
upstream ENSMUSE00000671053 Chr11:106938974..106939082 GGAGCTGGATTAGCAAGACG Chr11:106939044..106939063 59.98 55
upstream ENSMUSE00000671081 Chr11:106938974..106939082 GGAGCTGGATTAGCAAGACG Chr11:106939044..106939063 59.98 55
upstream ENSMUSE00000671052 Chr11:106937836..106938015 GGCAATGGAGCTGTCTAAGG Chr11:106937857..106937876 59.84 55
upstream ENSMUSE00000671080 Chr11:106937836..106938015 GGCAATGGAGCTGTCTAAGG Chr11:106937857..106937876 59.84 55
upstream ENSMUSE00000646795 Chr11:106933997..106934047 CCCTTCTCCTAGACCGACCT Chr11:106934013..106934032 59.69 60
upstream ENSMUSE00000671050 Chr11:106933997..106936304 TCACAGGACGATAGCAGCAC Chr11:106935566..106935585 60.02 55
upstream ENSMUSE00000671079 Chr11:106933997..106936304 TCACAGGACGATAGCAGCAC Chr11:106935566..106935585 60.02 55
upstream ENSMUSE00000671078 Chr11:106929589..106929713 GAGGAGGGTCTACACGGACA Chr11:106929590..106929609 60.11 60
upstream ENSMUSE00000710104 Chr11:106929589..106929713 GAGGAGGGTCTACACGGACA Chr11:106929590..106929609 60.11 60
upstream ENSMUSE00000719142 Chr11:106929589..106929713 GAGGAGGGTCTACACGGACA Chr11:106929590..106929609 60.11 60
upstream ENSMUSE00000352211 Chr11:106928441..106928569 CCCTTATGGCATTCGTTCTG Chr11:106928495..106928514 60.46 50
upstream ENSMUSE00000671048 Chr11:106928441..106928569 CCCTTATGGCATTCGTTCTG Chr11:106928495..106928514 60.46 50
upstream ENSMUSE00000390684 Chr11:106927260..106927410 ATCAGGGCTTTTGCTGAGAG Chr11:106927260..106927279 59.57 50
upstream ENSMUSE00000671046 Chr11:106927260..106927410 ATCAGGGCTTTTGCTGAGAG Chr11:106927260..106927279 59.57 50
upstream ENSMUSE00000344737 Chr11:106926982..106927024 AGAAAAGGCTCAAGCAGCAG Chr11:106926996..106927015 59.9 50
upstream ENSMUSE00000671045 Chr11:106926982..106927024 AGAAAAGGCTCAAGCAGCAG Chr11:106926996..106927015 59.9 50
upstream ENSMUSE00000404413 Chr11:106923850..106924096 CCTGGAACAAAGATGGTGCT Chr11:106923951..106923970 60.11 50
upstream ENSMUSE00000671044 Chr11:106923850..106924096 CCTGGAACAAAGATGGTGCT Chr11:106923951..106923970 60.11 50
upstream ENSMUSE00000671067 Chr11:106923364..106923525 AATTGCCACTTCCTGCAAAC Chr11:106923404..106923423 60.12 45
upstream ENSMUSE00000358525 Chr11:106922998..106923149 CTGCAGGAACCACTACCACA Chr11:106923004..106923023 59.74 55
upstream ENSMUSE00000671043 Chr11:106922998..106923149 CTGCAGGAACCACTACCACA Chr11:106923004..106923023 59.74 55
upstream ENSMUSE00000671041 Chr11:106921786..106921894 AAAGGCGATCATTCGAACAC Chr11:106921804..106921823 60.08 45
upstream ENSMUSE00000714899 Chr11:106921786..106921894 AAAGGCGATCATTCGAACAC Chr11:106921804..106921823 60.08 45
upstream ENSMUSE00000720302 Chr11:106921786..106921894 AAAGGCGATCATTCGAACAC Chr11:106921804..106921823 60.08 45
upstream ENSMUSE00000353016 Chr11:106919948..106920165 TGTTTCCACTGCCATCTCTG Chr11:106920103..106920122 59.83 50
upstream ENSMUSE00000671066 Chr11:106919948..106920165 TGTTTCCACTGCCATCTCTG Chr11:106920103..106920122 59.83 50
upstream ENSMUSE00000393473 Chr11:106917186..106917420 GGACAAGGGCAGACTACTGG Chr11:106917368..106917387 59.72 60
upstream ENSMUSE00000671065 Chr11:106917186..106917420 GGACAAGGGCAGACTACTGG Chr11:106917368..106917387 59.72 60
upstream ENSMUSE00000490446 Chr11:106915770..106916632 GTCACAGCCCCAGGTACAGT Chr11:106916162..106916181 60.03 60
upstream ENSMUSE00000671064 Chr11:106915770..106916632 GTCACAGCCCCAGGTACAGT Chr11:106916162..106916181 60.03 60
upstream ENSMUSE00000324110 Chr11:106914537..106914619 CCATGACTCCAGCTGAAAGAG Chr11:106914550..106914570 60 52.38
upstream ENSMUSE00000671063 Chr11:106914537..106914619 CCATGACTCCAGCTGAAAGAG Chr11:106914550..106914570 60 52.38
upstream ENSMUSE00000324100 Chr11:106914103..106914328 GCTCCTGGACAAAGAGTTGC Chr11:106914117..106914136 60 55
upstream ENSMUSE00000671062 Chr11:106914103..106914328 GCTCCTGGACAAAGAGTTGC Chr11:106914117..106914136 60 55
upstream ENSMUSE00000324091 Chr11:106908314..106908657 CCAAGAAGGACACCAGGCTA Chr11:106908349..106908368 60.25 55
upstream ENSMUSE00000671061 Chr11:106908314..106908657 CCAAGAAGGACACCAGGCTA Chr11:106908349..106908368 60.25 55
upstream ENSMUSE00000324085 Chr11:106904947..106905139 TATTGGCTGTGATCGGTGTC Chr11:106905114..106905133 59.53 50
upstream ENSMUSE00000671059 Chr11:106904947..106905139 TATTGGCTGTGATCGGTGTC Chr11:106905114..106905133 59.53 50
upstream ENSMUSE00000324075 Chr11:106903989..106904073 GGTAGACCCCAATGATGCAC Chr11:106904022..106904041 60.2 55
upstream ENSMUSE00000671058 Chr11:106903989..106904073 GGTAGACCCCAATGATGCAC Chr11:106904022..106904041 60.2 55
upstream ENSMUSE00000324067 Chr11:106901540..106901726 CTGACAGAGTTCGTGGCAGA Chr11:106901660..106901679 60.18 55
upstream ENSMUSE00000671056 Chr11:106901540..106901726 CTGACAGAGTTCGTGGCAGA Chr11:106901660..106901679 60.18 55
upstream ENSMUSE00000576190 Chr11:106896860..106897153 GTCCAACGGACAAAGGAAAA Chr11:106896940..106896959 59.95 45
upstream ENSMUSE00000671040 Chr11:106894397..106897153 ATAACGGCGGTAAGGCTTTT Chr11:106894606..106894625 59.99 45
upstream ENSMUSE00000671069 Chr11:106894397..106897153 ATAACGGCGGTAAGGCTTTT Chr11:106894606..106894625 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCACAAACGAAGGGTGCTT Chr11:106897181..106897201 60.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACAAACGAAGGGTGCTT Chr11:106897181..106897201 60.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040481