Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20472
Trapped Gene
Tfdp2 (ENSMUSG00000032411)
Vector Insertion
Chr 9: 96096980 - 96102549
Public Clones IST14380F2 (tigm) IST12771D6 (tigm) IST10985D9 (tigm) IST11845B9 (tigm)
Private Clones OST361092 (lexicon) OST275248 (lexicon) OST274605 (lexicon) OST232236 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634876 (Chr9:96096767..96096979 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTGACCCTTCCTGCACT Chr9:96096799..96096818 63.94 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634876 (Chr9:96096767..96096979 +)
Downstram Exon
ENSMUSE00000634875 (Chr9:96102550..96102607 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTGACCCTTCCTGCACT Chr9:96096799..96096818 63.94 60 CAGGGCTCTCTCTTCAGCAG Chr9:96102601..96102620 60.42 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634876 Chr9:96096767..96096979 GCCTTGACCCTTCCTGCACT Chr9:96096799..96096818 63.94 60

*** Putative Vector Insertion (Chr 9: 96096980 - 96102549) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634875 Chr9:96102550..96102607 CAGGGCTCTCTCTTCAGCAG Chr9:96102601..96102620 60.42 60
downstream ENSMUSE00000693791 Chr9:96133101..96133167 CTCAGCTCTGCATTTGTGGA Chr9:96133135..96133154 60.14 50
downstream ENSMUSE00000693790 Chr9:96147469..96147507 GACCCAGCAATTCCACTTGTA Chr9:96147504..96147524 59.99 47.62
downstream ENSMUSE00000219556 Chr9:96174258..96174361 GGCCCTAAGGTTTTCGGTAA Chr9:96174336..96174355 60.31 50
downstream ENSMUSE00000489999 Chr9:96188020..96188141 CAATTCTCTGCGGTGTGCTT Chr9:96188047..96188066 61.38 50
downstream ENSMUSE00000233223 Chr9:96190999..96191046 No primer for this exon
downstream ENSMUSE00000530945 Chr9:96195384..96195546 TTCCGCTGAACTTTCTCACA Chr9:96195467..96195486 59.57 45
downstream ENSMUSE00000693779 Chr9:96198043..96198189 CCTGAGCAGAATTGGTAGGC Chr9:96198175..96198194 59.84 55
downstream ENSMUSE00000462451 Chr9:96198046..96198189 CCTGAGCAGAATTGGTAGGC Chr9:96198175..96198194 59.84 55
downstream ENSMUSE00000530944 Chr9:96200791..96200859 TCTATCCGCCTCTGCTTCTC Chr9:96200816..96200835 59.68 55
downstream ENSMUSE00000530943 Chr9:96207219..96207370 TAAATGGCAGCTGAATGGTG Chr9:96207318..96207337 59.69 45
downstream ENSMUSE00000530942 Chr9:96210941..96211107 TGTCGTCGTGGATCTCAAAG Chr9:96210993..96211012 59.83 50
downstream ENSMUSE00000530941 Chr9:96217896..96218001 CCAAGAAGGTCCTGTGGAGA Chr9:96217921..96217940 60.23 55
downstream ENSMUSE00000459397 Chr9:96218207..96219400 CGTAAAAGCTTGCTCCGTTC Chr9:96218934..96218953 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGGAAATAATCGCCTTGC Chr9:96097023..96097043 59.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAACGTGACTGGGAAAA Chr9:96097025..96097045 61.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032411