Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20489
Trapped Gene
Utx (ENSMUSG00000037369)
Vector Insertion
Chr X: 17740574 - 17776283
Public Clones (sanger) (sanger) (sanger) (sanger) (ggtc) E119F12 (ggtc)
(ggtc) P136B08 (ggtc) IST14786E4 (tigm) IST14845F9 (tigm) IST14849F9 (tigm)
IST14475H9 (tigm)
Private Clones OST360766 (lexicon) OST291412 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503440 (ChrX:17740510..17740573 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503440 (ChrX:17740510..17740573 +)
Downstram Exon
ENSMUSE00000557269 (ChrX:17776284..17776392 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGATTCGTAGCAGCGAACA ChrX:17776308..17776327 59.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702729 ChrX:17739701..17740298 TACCGCGTTAGGATTTTTCG ChrX:17739973..17739992 60.09 45
upstream ENSMUSE00000457469 ChrX:17739793..17740298 TACCGCGTTAGGATTTTTCG ChrX:17739973..17739992 60.09 45
upstream ENSMUSE00000503440 ChrX:17740510..17740573 No primer for this exon

*** Putative Vector Insertion (Chr X: 17740574 - 17776283) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000557269 ChrX:17776284..17776392 GAGATTCGTAGCAGCGAACA ChrX:17776308..17776327 59.18 50
downstream ENSMUSE00000557267 ChrX:17785862..17785911 No primer for this exon
downstream ENSMUSE00000557262 ChrX:17794064..17794122 No primer for this exon
downstream ENSMUSE00000557258 ChrX:17799883..17800003 ATTTCCTTGGCTCGACAAAA ChrX:17799948..17799967 59.69 40
downstream ENSMUSE00000457430 ChrX:17810986..17811040 TTGGACAAAGTGCAGGGATT ChrX:17811035..17811054 60.49 45
downstream ENSMUSE00000557250 ChrX:17813787..17813821 GTGGGCAATGTGAAACTGAA ChrX:17813809..17813828 59.55 45
downstream ENSMUSE00000510606 ChrX:17815967..17816060 TCTGTCTGCAAAAGTTGCTCA ChrX:17816018..17816038 59.77 42.86
downstream ENSMUSE00000557245 ChrX:17818828..17818954 TTGGATCTGCTTCCAAGGAC ChrX:17818926..17818945 60.19 50
downstream ENSMUSE00000557241 ChrX:17823092..17823190 GCATCCTGAACTTTCCCAAT ChrX:17823127..17823146 58.98 45
downstream ENSMUSE00000557238 ChrX:17823323..17823542 TAATTCGTGCTGCAAGTCCA ChrX:17823534..17823553 60.4 45
downstream ENSMUSE00000557235 ChrX:17824101..17824235 GCTCCATGCCTCCTCAATAC ChrX:17824181..17824200 59.66 55
downstream ENSMUSE00000327156 ChrX:17825396..17825485 TGCCACCACTCCAATTATCA ChrX:17825426..17825445 59.92 45
downstream ENSMUSE00000327149 ChrX:17826879..17826980 CTTTCCAGCTGTTCCAGCAT ChrX:17826955..17826974 60.4 50
downstream ENSMUSE00000327142 ChrX:17827833..17828228 CAGGTAAGGCACGTTTCCAT ChrX:17828138..17828157 59.99 50
downstream ENSMUSE00000327138 ChrX:17831130..17831908 CACCGTCAATGTGTTTCCTG ChrX:17831390..17831409 60 50
downstream ENSMUSE00000557228 ChrX:17834962..17835091 GTCTTGGAGGCGGACATTTA ChrX:17835029..17835048 60.07 50
downstream ENSMUSE00000557225 ChrX:17838649..17838754 AACAGGGTTGTTTGGGTTTG ChrX:17838720..17838739 59.73 45
downstream ENSMUSE00000327122 ChrX:17839356..17839561 GGTTCCAGTAGGGTCCCAAT ChrX:17839471..17839490 60.05 55
downstream ENSMUSE00000327120 ChrX:17841074..17841138 No primer for this exon
downstream ENSMUSE00000557221 ChrX:17841212..17841286 TGTTGGTCCCAAACTTAATGG ChrX:17841266..17841286 59.71 42.86
downstream ENSMUSE00000557220 ChrX:17841688..17841836 TCTCACGAAGGCAGGAAGTT ChrX:17841739..17841758 59.99 50
downstream ENSMUSE00000557215 ChrX:17846274..17846388 AAACACCCCAGTAGCCTTCA ChrX:17846372..17846391 59.59 50
downstream ENSMUSE00000557211 ChrX:17848971..17849158 TCCAGACCAGATCTCCAGGT ChrX:17849083..17849102 59.64 55
downstream ENSMUSE00000557208 ChrX:17850074..17850215 CGTGCCATATTCCAGGAAAG ChrX:17850176..17850195 60.46 50
downstream ENSMUSE00000327083 ChrX:17852161..17852287 CCCGTGCCATATGATCTCTT ChrX:17852248..17852267 59.92 50
downstream ENSMUSE00000354140 ChrX:17854502..17854689 TTTTTCGTGCACAATCTTGG ChrX:17854592..17854611 59.71 40
downstream ENSMUSE00000557200 ChrX:17854502..17854672 TTTTTCGTGCACAATCTTGG ChrX:17854592..17854611 59.71 40
downstream ENSMUSE00000470278 ChrX:17855752..17856478 AGATGAGGCGGATGGTAATG ChrX:17855781..17855800 59.92 50
downstream ENSMUSE00000557198 ChrX:17855752..17857062 AGATGAGGCGGATGGTAATG ChrX:17855781..17855800 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTTCAGAAAATGTCAGG ChrX:17764593..17764613 58.85 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTAACACGTGACTGGGAAAA ChrX:17764617..17764639 59.17 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037369