Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2049
Trapped Gene
Lypla1 (ENSMUSG00000025903)
Vector Insertion
Chr 1: 4798568 - 4818664
Public Clones (sanger) AY0153 (sanger) (sanger) (sanger) (sanger) (sanger)
E001C01 (ggtc) Q011B06 (ggtc) D137H11 (ggtc) W244E03 (ggtc) (cmhd)
PST25140-NR (escells) IST14960H5 (tigm) IST15008G9 (tigm) IST10546B3 (tigm)
IST11354E7 (tigm) IST11830F1 (tigm) IST11389H4 (tigm) IST14185E11 (tigm)
IST10458D6 (tigm) IST12727G6 (tigm) IST13486D10 (tigm) IST12727G6 (tigm)
IST10607B3 (tigm) IST12742A5 (tigm) IST13053D12 (tigm) IST14660F6 (tigm)
IST12607B12 (tigm) IST11328E1 (tigm) IST12544B12 (tigm) IST13053D12 (tigm)
IST12742A5 (tigm)
Private Clones OST360347 (lexicon) OST351003 (lexicon) OST338538 (lexicon) OST338092 (lexicon)
OST335963 (lexicon) OST323845 (lexicon) OST291403 (lexicon) OST266688 (lexicon)
OST202889 (lexicon) OST194242 (lexicon) OST171525 (lexicon) OST153325 (lexicon)
OST149486 (lexicon) OST133392 (lexicon) OST123536 (lexicon) OST54581 (lexicon)
OST53516 (lexicon) OST34311 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000154054 (Chr1:4798536..4798567 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTCACGGATTGGGAGATA Chr1:4798544..4798563 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000154054 (Chr1:4798536..4798567 +)
Downstram Exon
ENSMUSE00000154050 (Chr1:4818665..4818730 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTCACGGATTGGGAGATA Chr1:4798544..4798563 59.89 50 TTTGATACCTGCAAAGGCTTC Chr1:4818700..4818720 59.35 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000154051 Chr1:4797943..4798063 No primer for this exon
upstream ENSMUSE00000703291 Chr1:4797992..4798063 No primer for this exon
upstream ENSMUSE00000154054 Chr1:4798536..4798567 CCTTCACGGATTGGGAGATA Chr1:4798544..4798563 59.89 50

*** Putative Vector Insertion (Chr 1: 4798568 - 4818664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000154050 Chr1:4818665..4818730 TTTGATACCTGCAAAGGCTTC Chr1:4818700..4818720 59.35 42.86
downstream ENSMUSE00000154052 Chr1:4820349..4820396 No primer for this exon
downstream ENSMUSE00000154053 Chr1:4822392..4822462 TGGGAATCTGGTGAAAGTCC Chr1:4822427..4822446 59.9 50
downstream ENSMUSE00000154057 Chr1:4827082..4827155 No primer for this exon
downstream ENSMUSE00000154056 Chr1:4829468..4829569 GACACCAGCCAGTTTCTGCT Chr1:4829527..4829546 60.45 55
downstream ENSMUSE00000154049 Chr1:4831037..4831213 GGCACTGGAGAACGGAAATA Chr1:4831085..4831104 60.07 50
downstream ENSMUSE00000154055 Chr1:4835044..4836817 AAAAAGCCTGGTCTCCCAAT Chr1:4835679..4835698 59.94 45
downstream ENSMUSE00000703290 Chr1:4835044..4835433 CAATGAAGTGCTTGACATCCA Chr1:4835073..4835093 59.71 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTGGCTGTAATCGCCTTG Chr1:4813610..4813630 61.05 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTAATGTGGCTGCGTGA Chr1:4813604..4813624 60.4 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025903