Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20496
Trapped Gene
Spire1 (ENSMUSG00000024533)
Vector Insertion
Chr 18: 67654931 - 67655016
Public Clones not available
Private Clones OST360598 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000625257 (Chr18:67655017..67655044 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTCACAGTGTTGCAAAAAG Chr18:67655017..67655037 60.08 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000625257 (Chr18:67655017..67655044 -)
Downstram Exon
ENSMUSE00000625256 (Chr18:67654794..67654930 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTCACAGTGTTGCAAAAAG Chr18:67655017..67655037 60.08 42.86 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000572268 Chr18:67770059..67770443 GAGATCCTGCGGCTCTACAA Chr18:67770253..67770272 60.5 55
upstream ENSMUSE00000572267 Chr18:67747479..67747513 No primer for this exon
upstream ENSMUSE00000572256 Chr18:67712228..67712375 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000572266 Chr18:67712228..67712461 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000701549 Chr18:67708778..67708827 No primer for this exon
upstream ENSMUSE00000457637 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60
upstream ENSMUSE00000701548 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60
upstream ENSMUSE00000143108 Chr18:67690061..67690138 GGAGGACCTGAAAAATGCAG Chr18:67690066..67690085 59.67 50
upstream ENSMUSE00000143125 Chr18:67688518..67688682 TTTGCGAAATGGGGTAAAAC Chr18:67688634..67688653 59.81 40
upstream ENSMUSE00000314225 Chr18:67679458..67679544 CCTCGGTTGAAAAAGAGTGC Chr18:67679507..67679526 59.85 50
upstream ENSMUSE00000709274 Chr18:67678945..67679074 AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55
upstream ENSMUSE00000721234 Chr18:67678945..67679074 AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55
upstream ENSMUSE00000572255 Chr18:67672495..67672533 No primer for this exon
upstream ENSMUSE00000701545 Chr18:67672495..67672533 No primer for this exon
upstream ENSMUSE00000625262 Chr18:67666208..67666380 TCACTACGCCAGAATCTCCA Chr18:67666358..67666377 59.39 50
upstream ENSMUSE00000701544 Chr18:67666208..67666380 TCACTACGCCAGAATCTCCA Chr18:67666358..67666377 59.39 50
upstream ENSMUSE00000625261 Chr18:67665305..67665398 GTGCGTCTCCCTCCCTCTAT Chr18:67665342..67665361 60.62 60
upstream ENSMUSE00000701543 Chr18:67665305..67665398 GTGCGTCTCCCTCCCTCTAT Chr18:67665342..67665361 60.62 60
upstream ENSMUSE00000625260 Chr18:67663085..67663227 ACGAACGTGAGGCAGTTTCT Chr18:67663116..67663135 59.91 50
upstream ENSMUSE00000701540 Chr18:67663085..67663227 ACGAACGTGAGGCAGTTTCT Chr18:67663116..67663135 59.91 50
upstream ENSMUSE00000572261 Chr18:67660722..67660895 GCCTTTCCGACCACTTTTCT Chr18:67660844..67660863 60.61 50
upstream ENSMUSE00000625259 Chr18:67656831..67656968 AAGTGATGCACATCCGTCAG Chr18:67656903..67656922 59.71 50
upstream ENSMUSE00000701539 Chr18:67656831..67656968 AAGTGATGCACATCCGTCAG Chr18:67656903..67656922 59.71 50
upstream ENSMUSE00000625258 Chr18:67656216..67656286 AACCCGGAGGTTTTCCTTCT Chr18:67656250..67656269 61.18 50
upstream ENSMUSE00000701538 Chr18:67656216..67656286 AACCCGGAGGTTTTCCTTCT Chr18:67656250..67656269 61.18 50
upstream ENSMUSE00000625257 Chr18:67655017..67655044 TGCTCACAGTGTTGCAAAAAG Chr18:67655017..67655037 60.08 42.86
upstream ENSMUSE00000701536 Chr18:67655017..67655044 TGCTCACAGTGTTGCAAAAAG Chr18:67655017..67655037 60.08 42.86

*** Putative Vector Insertion (Chr 18: 67654931 - 67655016) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000625256 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000701533 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000659122 Chr18:67647867..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55
downstream ENSMUSE00000659123 Chr18:67647863..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTGCTTACCGCCTCTGT Chr18:67654968..67654988 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTCACAGTGTTGCAAAAAG Chr18:67655015..67655036 60.08 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024533