Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20515
Trapped Gene
Zdhhc20 (ENSMUSG00000021969)
Vector Insertion
Chr 14: 58462152 - 58465757
Public Clones not available
Private Clones OST360132 (lexicon) OST356558 (lexicon) OST346607 (lexicon) OST205009 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307294 (Chr14:58465758..58465899 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGCAAAGTTCCACGTACT Chr14:58465853..58465872 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307294 (Chr14:58465758..58465899 -)
Downstram Exon
ENSMUSE00000307283 (Chr14:58462025..58462151 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGCAAAGTTCCACGTACT Chr14:58465853..58465872 59.94 50 TGCATCCAAGAGAGAAACCAT Chr14:58462067..58462087 59.69 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558391 Chr14:58508900..58509099 ACCTTTGTGGTCGTCTGGTC Chr14:58508932..58508951 60.01 55
upstream ENSMUSE00000122547 Chr14:58497270..58497296 No primer for this exon
upstream ENSMUSE00000122526 Chr14:58492730..58492833 CCTTGTGGCTTTCCATCTGT Chr14:58492798..58492817 60.11 50
upstream ENSMUSE00000122540 Chr14:58484358..58484478 ATTTTGAGAAGAGCGGCAAG Chr14:58484393..58484412 59.59 45
upstream ENSMUSE00000122541 Chr14:58477377..58477446 No primer for this exon
upstream ENSMUSE00000558401 Chr14:58476465..58476497 No primer for this exon
upstream ENSMUSE00000307301 Chr14:58475447..58475567 TTTGTGGCTGCAACAGTTTT Chr14:58475472..58475491 59.37 40
upstream ENSMUSE00000558399 Chr14:58468982..58469017 CTTTGCCGCAGGAAATCTAC Chr14:58468998..58469017 59.85 50
upstream ENSMUSE00000307294 Chr14:58465758..58465899 AGCGCAAAGTTCCACGTACT Chr14:58465853..58465872 59.94 50

*** Putative Vector Insertion (Chr 14: 58462152 - 58465757) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307283 Chr14:58462025..58462151 TGCATCCAAGAGAGAAACCAT Chr14:58462067..58462087 59.69 42.86
downstream ENSMUSE00000122534 Chr14:58459666..58459755 AGCTGGAAAACTGCAACCAT Chr14:58459706..58459725 59.74 45
downstream ENSMUSE00000122556 Chr14:58457927..58458042 TCACTGTCCAATAAGCGGTTT Chr14:58457952..58457972 59.62 42.86
downstream ENSMUSE00000354959 Chr14:58456428..58456504 No primer for this exon
downstream ENSMUSE00000615304 Chr14:58451539..58455483 TTTTGAGCTGTGAGGCAATG Chr14:58455259..58455278 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTACCATTGCTGGCTGGTTG Chr14:58462777..58462797 61.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCGTGACTGGGAAAACC Chr14:58462690..58462710 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021969