Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2052
Trapped Gene
Cltc (ENSMUSG00000047126)
Vector Insertion
Chr 11: 86531399 - 86531564
Public Clones AW0865 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675183 (Chr11:86531400..86531563 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATATATTCAGGCGGCTTGC Chr11:86531484..86531503 59.2 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675183 (Chr11:86531400..86531563 -)
Downstram Exon
ENSMUSE00000336457 (Chr11:86531400..86531563 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATATATTCAGGCGGCTTGC Chr11:86531484..86531503 59.2 45 GCTCGGGATCATAGCAGTTG Chr11:86531398..86531417 60.76 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439974 Chr11:86570750..86570995 GAGACCATACTCCCCGACAG Chr11:86570796..86570815 59.53 60
upstream ENSMUSE00000661529 Chr11:86570750..86570994 GAGACCATACTCCCCGACAG Chr11:86570796..86570815 59.53 60
upstream ENSMUSE00000661528 Chr11:86550573..86550780 ATCCTGCCAGCAAAGTGATT Chr11:86550583..86550602 59.7 45
upstream ENSMUSE00000675211 Chr11:86550573..86550780 ATCCTGCCAGCAAAGTGATT Chr11:86550583..86550602 59.7 45
upstream ENSMUSE00000366296 Chr11:86550561..86550780 ATCCTGCCAGCAAAGTGATT Chr11:86550583..86550602 59.7 45
upstream ENSMUSE00000577864 Chr11:86547078..86547346 GAAGGCCCATACCATGACTG Chr11:86547281..86547300 60.34 55
upstream ENSMUSE00000675209 Chr11:86547078..86547346 GAAGGCCCATACCATGACTG Chr11:86547281..86547300 60.34 55
upstream ENSMUSE00000577863 Chr11:86546007..86546168 AGGGCATGCAGCTAGTTTTG Chr11:86546084..86546103 60.41 50
upstream ENSMUSE00000675207 Chr11:86546007..86546168 AGGGCATGCAGCTAGTTTTG Chr11:86546084..86546103 60.41 50
upstream ENSMUSE00000577862 Chr11:86544220..86544333 GGAATCAACCCTTCCCAAAG Chr11:86544280..86544299 60.66 50
upstream ENSMUSE00000675203 Chr11:86544220..86544333 GGAATCAACCCTTCCCAAAG Chr11:86544280..86544299 60.66 50
upstream ENSMUSE00000508302 Chr11:86543713..86543886 GAATCAGCGGAGAAACCATC Chr11:86543773..86543792 59.63 50
upstream ENSMUSE00000675200 Chr11:86543713..86543886 GAATCAGCGGAGAAACCATC Chr11:86543773..86543792 59.63 50
upstream ENSMUSE00000391484 Chr11:86539757..86539954 AGAACTCTTTGCCCGGAAAT Chr11:86539822..86539841 60.07 45
upstream ENSMUSE00000675198 Chr11:86539757..86539954 AGAACTCTTTGCCCGGAAAT Chr11:86539822..86539841 60.07 45
upstream ENSMUSE00000350882 Chr11:86538573..86538773 CCAGGTCAAACGTCACCTCT Chr11:86538700..86538719 60.15 55
upstream ENSMUSE00000675196 Chr11:86538573..86538773 CCAGGTCAAACGTCACCTCT Chr11:86538700..86538719 60.15 55
upstream ENSMUSE00000373263 Chr11:86535677..86535829 CCTCAGGGCCAATGTACCTA Chr11:86535742..86535761 59.95 55
upstream ENSMUSE00000675193 Chr11:86535677..86535829 CCTCAGGGCCAATGTACCTA Chr11:86535742..86535761 59.95 55
upstream ENSMUSE00000407509 Chr11:86535077..86535199 CGGATCAGTCCAGATCAAGG Chr11:86535135..86535154 60.61 55
upstream ENSMUSE00000675191 Chr11:86535077..86535199 CGGATCAGTCCAGATCAAGG Chr11:86535135..86535154 60.61 55
upstream ENSMUSE00000387053 Chr11:86533752..86533889 GAACCTTATGCACGCACCTC Chr11:86533754..86533773 60.67 55
upstream ENSMUSE00000675189 Chr11:86533752..86533889 GAACCTTATGCACGCACCTC Chr11:86533754..86533773 60.67 55
upstream ENSMUSE00000348745 Chr11:86532961..86533125 CCATTCTCGGGAATCAGATG Chr11:86533096..86533115 60.42 50
upstream ENSMUSE00000675186 Chr11:86532961..86533125 CCATTCTCGGGAATCAGATG Chr11:86533096..86533115 60.42 50
upstream ENSMUSE00000389072 Chr11:86532688..86532868 TCCCTAGAATGCCTCAGAGC Chr11:86532810..86532829 59.53 55
upstream ENSMUSE00000675184 Chr11:86532688..86532868 TCCCTAGAATGCCTCAGAGC Chr11:86532810..86532829 59.53 55
upstream ENSMUSE00000336457 Chr11:86531400..86531563 AATATATTCAGGCGGCTTGC Chr11:86531484..86531503 59.2 45
upstream ENSMUSE00000675183 Chr11:86531400..86531563 AATATATTCAGGCGGCTTGC Chr11:86531484..86531503 59.2 45

*** Putative Vector Insertion (Chr 11: 86531399 - 86531564) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362532 Chr11:86526083..86526208 CCAGGTCATGGACAAAGTCA Chr11:86526117..86526136 59.52 50
downstream ENSMUSE00000675180 Chr11:86526083..86526208 CCAGGTCATGGACAAAGTCA Chr11:86526117..86526136 59.52 50
downstream ENSMUSE00000350824 Chr11:86525349..86525491 GAGCAGTCAACATCCAGCAA Chr11:86525414..86525433 59.99 50
downstream ENSMUSE00000675178 Chr11:86525349..86525491 GAGCAGTCAACATCCAGCAA Chr11:86525414..86525433 59.99 50
downstream ENSMUSE00000392135 Chr11:86524843..86525077 CACACTGGCCACGTTCATAA Chr11:86524838..86524857 60.57 50
downstream ENSMUSE00000675175 Chr11:86524843..86525077 CACACTGGCCACGTTCATAA Chr11:86524838..86524857 60.57 50
downstream ENSMUSE00000333361 Chr11:86522452..86522574 TGGATCCTTTCGACGGACTA Chr11:86522490..86522509 60.59 50
downstream ENSMUSE00000675174 Chr11:86522452..86522574 TGGATCCTTTCGACGGACTA Chr11:86522490..86522509 60.59 50
downstream ENSMUSE00000395972 Chr11:86520972..86521117 TGGGTCCTGAGTTTCAGACA Chr11:86521060..86521079 59.23 50
downstream ENSMUSE00000675172 Chr11:86520972..86521117 TGGGTCCTGAGTTTCAGACA Chr11:86521060..86521079 59.23 50
downstream ENSMUSE00000345377 Chr11:86520554..86520737 CGTGTTCGGTCAGCCTTAAT Chr11:86520665..86520684 60.13 50
downstream ENSMUSE00000675171 Chr11:86520554..86520737 CGTGTTCGGTCAGCCTTAAT Chr11:86520665..86520684 60.13 50
downstream ENSMUSE00000389324 Chr11:86520169..86520361 AGCCTGGACAACTTCCATGT Chr11:86520160..86520179 59.58 50
downstream ENSMUSE00000675167 Chr11:86520169..86520361 AGCCTGGACAACTTCCATGT Chr11:86520160..86520179 59.58 50
downstream ENSMUSE00000348198 Chr11:86519475..86519632 CTAATTCTGCAAGGCGGTTT Chr11:86519494..86519513 59.36 45
downstream ENSMUSE00000649333 Chr11:86519475..86519632 CTAATTCTGCAAGGCGGTTT Chr11:86519494..86519513 59.36 45
downstream ENSMUSE00000412568 Chr11:86518648..86518812 CAACTGCTGCCTGATACTCG Chr11:86518667..86518686 59.62 55
downstream ENSMUSE00000649332 Chr11:86518648..86518812 CAACTGCTGCCTGATACTCG Chr11:86518667..86518686 59.62 55
downstream ENSMUSE00000362493 Chr11:86518390..86518497 TGGAGTCCACACATCTGAGC Chr11:86518417..86518436 59.83 55
downstream ENSMUSE00000649331 Chr11:86518390..86518497 TGGAGTCCACACATCTGAGC Chr11:86518417..86518436 59.83 55
downstream ENSMUSE00000383813 Chr11:86518142..86518309 TCTCGACCAGAACAACTCCA Chr11:86518135..86518154 59.39 50
downstream ENSMUSE00000649330 Chr11:86518142..86518309 TCTCGACCAGAACAACTCCA Chr11:86518135..86518154 59.39 50
downstream ENSMUSE00000343542 Chr11:86517582..86517731 TGTCTTTGAACTGCCCTTCC Chr11:86517571..86517590 60.23 50
downstream ENSMUSE00000649329 Chr11:86517582..86517731 TGTCTTTGAACTGCCCTTCC Chr11:86517571..86517590 60.23 50
downstream ENSMUSE00000407896 Chr11:86517373..86517504 ACTGCACGAGTGTGATCCAA Chr11:86517367..86517386 60.32 50
downstream ENSMUSE00000649328 Chr11:86517373..86517504 ACTGCACGAGTGTGATCCAA Chr11:86517367..86517386 60.32 50
downstream ENSMUSE00000356356 Chr11:86517166..86517276 TGGTTCTGCACTGAGCGTAA Chr11:86517205..86517224 60.6 50
downstream ENSMUSE00000398849 Chr11:86516103..86516273 CAAACGCTGAGCAAGTGAGA Chr11:86516189..86516208 60.32 50
downstream ENSMUSE00000357846 Chr11:86515711..86515932 CTGGATGAAATAGGGCATGG Chr11:86515713..86515732 60.29 50
downstream ENSMUSE00000649327 Chr11:86514563..86514583 No primer for this exon
downstream ENSMUSE00000373572 Chr11:86510767..86510842 AGCGACTCCGAAGCATCTAA Chr11:86510792..86510811 60.12 50
downstream ENSMUSE00000705983 Chr11:86509068..86509192 CCCATACGGTGGTGCAGTAT Chr11:86509079..86509098 60.66 55
downstream ENSMUSE00000439707 Chr11:86508161..86509192 AGAACACGTTGCCTGTTTCC Chr11:86508953..86508972 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTTCTGGGGTCCATTGTT Chr11:86531533..86531553 58.21 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr11:86531497..86531517 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047126