Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20524
Trapped Gene
Myo10 (ENSMUSG00000022272)
Vector Insertion
Chr 15: 25595412 - 25596175
Public Clones not available
Private Clones OST360022 (lexicon) OST316933 (lexicon) OST37753 (lexicon) OST35603 (lexicon)
OST30961 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684011 (Chr15:25595399..25595411 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684011 (Chr15:25595399..25595411 +)
Downstram Exon
ENSMUSE00000684010 (Chr15:25596176..25596279 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCCCATAGTCTGTCTGGAA Chr15:25596281..25596300 59.24 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000624397 Chr15:25552280..25552785 GTTTGCTGGTGATCCGAAGT Chr15:25552371..25552390 60.12 50
upstream ENSMUSE00000684011 Chr15:25595399..25595411 No primer for this exon

*** Putative Vector Insertion (Chr 15: 25595412 - 25596175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684010 Chr15:25596176..25596279 TGCCCATAGTCTGTCTGGAA Chr15:25596281..25596300 59.24 50
downstream ENSMUSE00000451753 Chr15:25596181..25596279 TGCCCATAGTCTGTCTGGAA Chr15:25596281..25596300 59.24 50
downstream ENSMUSE00000563015 Chr15:25631317..25631475 TTTGTAGCGCTGGAAAAGGT Chr15:25631463..25631482 59.88 45
downstream ENSMUSE00000563013 Chr15:25643784..25643971 CACAAGCAGCGATAGCATTC Chr15:25643941..25643960 59.6 50
downstream ENSMUSE00000563011 Chr15:25651925..25652059 GCTGATGACGGACAGGAACT Chr15:25651994..25652013 60.27 55
downstream ENSMUSE00000464787 Chr15:25653639..25653763 AGCGACTGGAGTTGTTGTTG Chr15:25653700..25653719 58.93 50
downstream ENSMUSE00000649969 Chr15:25654827..25654840 No primer for this exon
downstream ENSMUSE00000486227 Chr15:25654951..25655035 CTGCCAGCAGTGCATAGAAT Chr15:25655017..25655036 59.05 50
downstream ENSMUSE00000483446 Chr15:25656175..25656278 GGTCGCTGATCGTCTTGTCT Chr15:25656258..25656277 60.42 55
downstream ENSMUSE00000484558 Chr15:25661725..25661854 TCTATGTTGCCGAGATGCAG Chr15:25661816..25661835 59.97 50
downstream ENSMUSE00000489860 Chr15:25663743..25663861 CTGAGAGGCGTCAGGATCTC Chr15:25663854..25663873 60.1 60
downstream ENSMUSE00000563006 Chr15:25665701..25665847 GATGCCGATGGATTTGAAGT Chr15:25665820..25665839 59.9 45
downstream ENSMUSE00000563004 Chr15:25666156..25666256 TTCCTGAAGCTTTTCATTTGC Chr15:25666211..25666231 59.47 38.1
downstream ENSMUSE00000563002 Chr15:25666350..25666416 No primer for this exon
downstream ENSMUSE00000563001 Chr15:25667205..25667297 AAGTGCTGTCTGTGGCTTGA Chr15:25667271..25667290 59.62 50
downstream ENSMUSE00000562998 Chr15:25667712..25667780 CATAATGCTTCACGCCAAAA Chr15:25667775..25667794 59.7 40
downstream ENSMUSE00000562997 Chr15:25669042..25669124 CCTCGGACATCATACTGCAC Chr15:25669064..25669083 59.12 55
downstream ENSMUSE00000562995 Chr15:25672096..25672204 CTTCCGCATTTCAAGGTGTC Chr15:25672170..25672189 60.64 50
downstream ENSMUSE00000562992 Chr15:25673931..25674011 GGCTTGATGCATCTGACAAA Chr15:25674001..25674020 59.81 45
downstream ENSMUSE00000624376 Chr15:25682665..25683075 TTGACCATAGGTGCCATTGA Chr15:25682835..25682854 59.92 45
downstream ENSMUSE00000684000 Chr15:25682743..25683075 TTGACCATAGGTGCCATTGA Chr15:25682835..25682854 59.92 45
downstream ENSMUSE00000562961 Chr15:25705776..25705900 ATACCCTGCTTTCCGAATCC Chr15:25705868..25705887 60.29 50
downstream ENSMUSE00000562960 Chr15:25706073..25706187 TCATAGACCTGCAGGAGCAC Chr15:25706153..25706172 58.99 55
downstream ENSMUSE00000649963 Chr15:25707836..25707942 GCACGGTCAATCTCCTCTTC Chr15:25707903..25707922 59.81 55
downstream ENSMUSE00000649961 Chr15:25709338..25709565 ACCACACCACAGAGGACCTT Chr15:25709373..25709392 59.45 55
downstream ENSMUSE00000649959 Chr15:25710119..25710167 GGAGGTCAGCTTCTCTTTGC Chr15:25710156..25710175 59.17 55
downstream ENSMUSE00000649957 Chr15:25710729..25711619 TCCTCGTAATCGTCCTGGTC Chr15:25711483..25711502 60.07 55
downstream ENSMUSE00000649953 Chr15:25712673..25712796 AGTCTCGCCGGTAGGAAAGT Chr15:25712745..25712764 60.27 55
downstream ENSMUSE00000649950 Chr15:25715558..25715801 CTCGTCCTTCAGGACACACC Chr15:25715610..25715629 60.71 60
downstream ENSMUSE00000649948 Chr15:25722906..25723001 GATGATGTCGATCCCGTTCT Chr15:25722954..25722973 59.89 50
downstream ENSMUSE00000649946 Chr15:25725438..25725531 GTCTGTGGACGAGTGGACCT Chr15:25725483..25725502 60.16 60
downstream ENSMUSE00000649943 Chr15:25726954..25727009 CAGAGGCGCATACAGAATCA Chr15:25726999..25727018 59.97 50
downstream ENSMUSE00000649940 Chr15:25729166..25729308 CAGCAGGGTTATCCAGTGGT Chr15:25729259..25729278 59.99 55
downstream ENSMUSE00000649936 Chr15:25729796..25729990 AGGGAGGACATCTTCGGACT Chr15:25729844..25729863 60.07 55
downstream ENSMUSE00000649933 Chr15:25730878..25731035 CCATACACGGTGACATTCCA Chr15:25730905..25730924 60.24 50
downstream ENSMUSE00000649931 Chr15:25733018..25733141 CTCCACCACGTCAGAGTTGA Chr15:25733050..25733069 59.86 55
downstream ENSMUSE00000649929 Chr15:25734054..25734351 GGCACCTTGTTGGTCTGTTT Chr15:25734243..25734262 60.01 50
downstream ENSMUSE00000649927 Chr15:25735266..25735473 CTTCTCCATCTCGGTTCCTG Chr15:25735305..25735324 59.8 55
downstream ENSMUSE00000649925 Chr15:25736298..25736434 CCACCTGTCCGTTGTACTCA Chr15:25736382..25736401 59.59 55
downstream ENSMUSE00000649922 Chr15:25736812..25736932 GCAAACTCCACGCTGTCTTT Chr15:25736919..25736938 60.44 50
downstream ENSMUSE00000649920 Chr15:25737491..25737943 TGATCCATAACCAGGCCACT Chr15:25737928..25737947 60.34 50
downstream ENSMUSE00000649919 Chr15:25740114..25740305 CCGCTCGTCAACTACGATCT Chr15:25740284..25740303 60.42 55
downstream ENSMUSE00000404800 Chr15:25741876..25743426 TTGTGAGCAGACTCGTTTGG Chr15:25743335..25743354 60.03 50
downstream ENSMUSE00000562965 Chr15:25741876..25741980 CACAGAGCGTGTGGTGCTAT Chr15:25741956..25741975 59.93 55
downstream ENSMUSE00000684019 Chr15:25741876..25743428 TTGTGAGCAGACTCGTTTGG Chr15:25743335..25743354 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000022272