Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20534
Trapped Gene
Phpt1 (ENSMUSG00000036504)
Vector Insertion
Chr 2: 25429220 - 25429707
Public Clones not available
Private Clones OST359451 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000239339 (Chr2:25429708..25429832 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTGCAAAGGAATGGCTA Chr2:25429787..25429806 60.49 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000239339 (Chr2:25429708..25429832 -)
Downstram Exon
ENSMUSE00000239333 (Chr2:25428951..25429219 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTGCAAAGGAATGGCTA Chr2:25429787..25429806 60.49 50 CCAGATTGGTCTGGCCTCTA Chr2:25428962..25428981 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406406 Chr2:25430203..25430391 CGGATGGCGTCTTCAAGTAT Chr2:25430297..25430316 60.1 50
upstream ENSMUSE00000239339 Chr2:25429708..25429832 GAGCTGCAAAGGAATGGCTA Chr2:25429787..25429806 60.49 50

*** Putative Vector Insertion (Chr 2: 25429220 - 25429707) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239333 Chr2:25428951..25429219 CCAGATTGGTCTGGCCTCTA Chr2:25428962..25428981 60.21 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTGTGTAATCGCCTTGC Chr2:25429644..25429664 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCACCTTTGTGCGTGACTG Chr2:25429648..25429668 60.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036504