Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20539
Trapped Gene
Igf2bp2 (ENSMUSG00000033581)
Vector Insertion
Chr 16: 22068333 - 22070379
Public Clones not available
Private Clones OST359379 (lexicon) OST314128 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644781 (Chr16:22070380..22070448 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTCCGGATACTTCTCCA Chr16:22070427..22070446 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644781 (Chr16:22070380..22070448 -)
Downstram Exon
ENSMUSE00000310847 (Chr16:22068216..22068332 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTCCGGATACTTCTCCA Chr16:22070427..22070446 60.06 55 TGGGTTGGGATGAAGAGACT Chr16:22068270..22068289 59.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000333342 Chr16:22162859..22163107 CTACTCAAGTCCGGCTACGC Chr16:22162915..22162934 60.04 60
upstream ENSMUSE00000310923 Chr16:22161319..22161379 AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40
upstream ENSMUSE00000702656 Chr16:22161319..22161523 AGTGGAATTGCATGGGAAAA Chr16:22161356..22161375 60.31 40
upstream ENSMUSE00000702654 Chr16:22121270..22121322 TTCACAGTGGCCAAGGTATG Chr16:22121295..22121314 59.57 50
upstream ENSMUSE00000310911 Chr16:22089135..22089183 GAATCCAGATTCGGAACATCC Chr16:22089155..22089175 60.66 47.62
upstream ENSMUSE00000560970 Chr16:22087601..22087652 TGGCTGAATATGGGACAGTG Chr16:22087617..22087636 59.52 50
upstream ENSMUSE00000310892 Chr16:22083997..22084060 No primer for this exon
upstream ENSMUSE00000310885 Chr16:22081807..22082058 GAAGCTCAGTGGGCATCAGT Chr16:22082030..22082049 60.42 55
upstream ENSMUSE00000310877 Chr16:22080140..22080274 GCCTGTCACAATCCATGCTA Chr16:22080213..22080232 59.68 50
upstream ENSMUSE00000310871 Chr16:22079557..22079679 ATGGCTTCGTTGGAAGACTG Chr16:22079625..22079644 60.26 50
upstream ENSMUSE00000310865 Chr16:22078689..22078824 GCCTTTGAGAACGACATGCT Chr16:22078699..22078718 60.41 50
upstream ENSMUSE00000310855 Chr16:22076090..22076218 TTCGACTGGACTGTCTGTGC Chr16:22076149..22076168 60.03 55
upstream ENSMUSE00000644781 Chr16:22070380..22070448 CCACTCCGGATACTTCTCCA Chr16:22070427..22070446 60.06 55

*** Putative Vector Insertion (Chr 16: 22068333 - 22070379) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310847 Chr16:22068216..22068332 TGGGTTGGGATGAAGAGACT Chr16:22068270..22068289 59.51 50
downstream ENSMUSE00000644775 Chr16:22065166..22065240 TAAACTGGGCTTCAGGAGGA Chr16:22065146..22065165 59.81 50
downstream ENSMUSE00000644773 Chr16:22063655..22063786 GGCCTCCAGCTTCACTTCTT Chr16:22063690..22063709 60.9 55
downstream ENSMUSE00000644771 Chr16:22061933..22062046 AATGCCCGATAATTCTGACG Chr16:22061925..22061944 59.92 45
downstream ENSMUSE00000702655 Chr16:22059533..22060958 GTGGTTCGCATTTGTTCCTT Chr16:22059835..22059854 59.98 45
downstream ENSMUSE00000644770 Chr16:22059149..22060958 CTCACGGCACGTACCCTATT Chr16:22059228..22059247 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCACATCATCACTCCGTA Chr16:22070375..22070395 59.92 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCACATCATCACTCCGTA Chr16:22070375..22070395 59.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033581