Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20556
Trapped Gene
Prr6 (ENSMUSG00000018509)
Vector Insertion
Chr 11: 62338790 - 62340993
Public Clones IST12771A12 (tigm)
Private Clones OST358864 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000106584 (Chr11:62340994..62341108 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000106584 (Chr11:62340994..62341108 -)
Downstram Exon
ENSMUSE00000106587 (Chr11:62338448..62338789 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335488 Chr11:62352358..62352763 No primer for this exon
upstream ENSMUSE00000106582 Chr11:62349784..62349882 No primer for this exon
upstream ENSMUSE00000106583 Chr11:62347387..62347456 No primer for this exon
upstream ENSMUSE00000106584 Chr11:62340994..62341108 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62338790 - 62340993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000106587 Chr11:62338448..62338789 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGTGAACGGAGTGTCTGC Chr11:62340971..62340991 60.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGTGAACGGAGTGTCTGC Chr11:62340971..62340991 60.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGTGCTGAGAGCATAACCA Chr11:62341088..62341108 61.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGTGCTGAGAGCATAACCA Chr11:62341088..62341108 61.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018509