Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20557
Trapped Gene
Pdcd2 (ENSMUSG00000014771)
Vector Insertion
Chr 17: 15663577 - 15663954
Public Clones not available
Private Clones OST358862 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000395363 (Chr17:15663955..15664245 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000395363 (Chr17:15663955..15664245 -)
Downstram Exon
ENSMUSE00000238889 (Chr17:15663337..15663576 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395363 Chr17:15663955..15664245 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15663577 - 15663954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238889 Chr17:15663337..15663576 No primer for this exon
downstream ENSMUSE00000238861 Chr17:15662233..15662364 No primer for this exon
downstream ENSMUSE00000238832 Chr17:15659767..15659870 No primer for this exon
downstream ENSMUSE00000412149 Chr17:15658880..15658993 No primer for this exon
downstream ENSMUSE00000238788 Chr17:15658525..15658757 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr17:15663884..15663904 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGACGTGACTGGGAAAACC Chr17:15663887..15663907 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014771