Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20569
Trapped Gene
Fkbp4 (ENSMUSG00000030357)
Vector Insertion
Chr 6: 128382680 - 128383123
Public Clones not available
Private Clones OST358485 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197799 (Chr6:128383124..128383309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGCCTCACACCTCAATC Chr6:128383183..128383202 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197799 (Chr6:128383124..128383309 -)
Downstram Exon
ENSMUSE00000197802 (Chr6:128382440..128382679 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGCCTCACACCTCAATC Chr6:128383183..128383202 60.12 55 GCTCTTGCCAGGTCAAAGTC Chr6:128382569..128382588 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371281 Chr6:128388424..128388649 CCTCTCGAAGGAGTGGACAT Chr6:128388455..128388474 59.25 55
upstream ENSMUSE00000197796 Chr6:128386588..128386732 ACACTGGCTGGCTGCTAGAT Chr6:128386649..128386668 60.04 55
upstream ENSMUSE00000197797 Chr6:128385732..128385874 GAAGTGTGCCACATCACCTG Chr6:128385805..128385824 60.16 55
upstream ENSMUSE00000197793 Chr6:128384770..128384890 TGATGGTGCTATGGTGGAAG Chr6:128384770..128384789 59.52 50
upstream ENSMUSE00000197800 Chr6:128384323..128384479 CTGGAAGGCTACCACAAGGA Chr6:128384455..128384474 60.25 55
upstream ENSMUSE00000197798 Chr6:128383721..128383811 CACGCTGAGCTGAGGTATGA Chr6:128383746..128383765 60.16 55
upstream ENSMUSE00000550283 Chr6:128383544..128383627 CCAAGGAGTCTTGGGAGATG Chr6:128383607..128383626 59.65 55
upstream ENSMUSE00000197799 Chr6:128383124..128383309 ACTGGCCTCACACCTCAATC Chr6:128383183..128383202 60.12 55

*** Putative Vector Insertion (Chr 6: 128382680 - 128383123) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197802 Chr6:128382440..128382679 GCTCTTGCCAGGTCAAAGTC Chr6:128382569..128382588 60 55
downstream ENSMUSE00000396358 Chr6:128380125..128380898 GGCTACGCTTCTGTCTCCAC Chr6:128380770..128380789 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCAGAGGACGTAACAGC Chr6:128383095..128383115 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCAGAGGACGTAACAGC Chr6:128383095..128383115 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030357