Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20575
Trapped Gene
Stim2 (ENSMUSG00000039156)
Vector Insertion
Chr 5: 54444746 - 54466518
Public Clones not available
Private Clones OST358272 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000467933 (Chr5:54444615..54444745 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGGACGACGACAAGGAC Chr5:54444696..54444715 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000467933 (Chr5:54444615..54444745 +)
Downstram Exon
ENSMUSE00000599450 (Chr5:54466519..54466633 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGGACGACGACAAGGAC Chr5:54444696..54444715 60.12 55 CCACTGTTTCCACAAATCCTC Chr5:54466622..54466642 59.44 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000599451 Chr5:54389762..54390273 ATAACCGGAACCAATGAACG Chr5:54389912..54389931 59.69 45
upstream ENSMUSE00000722043 Chr5:54389762..54390273 ATAACCGGAACCAATGAACG Chr5:54389912..54389931 59.69 45
upstream ENSMUSE00000697206 Chr5:54389809..54390273 ATAACCGGAACCAATGAACG Chr5:54389912..54389931 59.69 45
upstream ENSMUSE00000467933 Chr5:54444615..54444745 AGATGGACGACGACAAGGAC Chr5:54444696..54444715 60.12 55

*** Putative Vector Insertion (Chr 5: 54444746 - 54466518) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599450 Chr5:54466519..54466633 CCACTGTTTCCACAAATCCTC Chr5:54466622..54466642 59.44 47.62
downstream ENSMUSE00000599449 Chr5:54493814..54493925 CAGGGTATCCTCAAGTGTCCA Chr5:54493844..54493864 59.97 52.38
downstream ENSMUSE00000599448 Chr5:54494812..54494927 GACTTCGGTCGCTGATTTTC Chr5:54494873..54494892 59.82 50
downstream ENSMUSE00000473651 Chr5:54495632..54495809 ACAACCCCCAACACCAATTA Chr5:54495702..54495721 59.95 45
downstream ENSMUSE00000420718 Chr5:54496460..54496637 TTTTCCGTTCCAGATTTTGC Chr5:54496527..54496546 60.05 40
downstream ENSMUSE00000653335 Chr5:54496609..54496637 CTCCAGTTCCTGCTCTGCAT Chr5:54496637..54496656 60.56 55
downstream ENSMUSE00000420711 Chr5:54500942..54501109 GCCATTTCTGTAGTGCGTCA Chr5:54501026..54501045 59.87 50
downstream ENSMUSE00000653334 Chr5:54500942..54500951 No primer for this exon
downstream ENSMUSE00000545087 Chr5:54500954..54501109 TCTGTAGTGCGTCAGGGACA Chr5:54501020..54501039 60.46 55
downstream ENSMUSE00000697200 Chr5:54501355..54501378 No primer for this exon
downstream ENSMUSE00000278198 Chr5:54501776..54501876 GGTCCCAAAGACTGTGCTTC Chr5:54501820..54501839 59.7 55
downstream ENSMUSE00000545096 Chr5:54502111..54502349 GGGTGTGTCTTCATCGAGGT Chr5:54502330..54502349 59.97 55
downstream ENSMUSE00000420703 Chr5:54502249..54502349 GGGTGTGTCTTCATCGAGGT Chr5:54502330..54502349 59.97 55
downstream ENSMUSE00000278186 Chr5:54507158..54507431 TCCTCCTCTTCGTTCCGATA Chr5:54507401..54507420 59.77 50
downstream ENSMUSE00000278182 Chr5:54509511..54511442 GCTGTCCTATGCGAGGCTAC Chr5:54511266..54511285 60.01 60
downstream ENSMUSE00000599447 Chr5:54509511..54510945 CACGTCAGCCGAGTCACTTA Chr5:54510004..54510023 60.05 55
downstream ENSMUSE00000707074 Chr5:54509511..54509988 CTGAGGAGCACGATGTGTGT Chr5:54509851..54509870 59.9 55
downstream ENSMUSE00000715041 Chr5:54509511..54512296 GCTGTCCTATGCGAGGCTAC Chr5:54511266..54511285 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATATAATCGCCTTGCAGCAC Chr5:54450793..54450814 59.72 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACATGTGTGCTTTGGGAAA Chr5:54450770..54450790 59.55 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039156