Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20577
Trapped Gene
Rtkn2 (ENSMUSG00000037846)
Vector Insertion
Chr 10: 67442561 - 67450054
Public Clones not available
Private Clones OST358254 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666222 (Chr10:67442346..67442560 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666222 (Chr10:67442346..67442560 +)
Downstram Exon
ENSMUSE00000612270 (Chr10:67450055..67450251 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60 TTTCGTACTCAGCGAGAGCA Chr10:67450138..67450157 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717549 Chr10:67442318..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000666222 Chr10:67442346..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000575810 Chr10:67442353..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000720154 Chr10:67442463..67442560 No primer for this exon

*** Putative Vector Insertion (Chr 10: 67442561 - 67450054) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612270 Chr10:67450055..67450251 TTTCGTACTCAGCGAGAGCA Chr10:67450138..67450157 59.89 50
downstream ENSMUSE00000666218 Chr10:67450055..67450260 TTTCGTACTCAGCGAGAGCA Chr10:67450138..67450157 59.89 50
downstream ENSMUSE00000612269 Chr10:67460313..67460371 GACAGGGCGATCTTTCCTCT Chr10:67460372..67460391 60.74 55
downstream ENSMUSE00000612268 Chr10:67464672..67464725 AGTGATCGGAGTCTTTCCACA Chr10:67464712..67464732 59.71 47.62
downstream ENSMUSE00000612267 Chr10:67465952..67466069 AATCACCATGTCCGTGTCAA Chr10:67466025..67466044 59.81 45
downstream ENSMUSE00000612266 Chr10:67468248..67468442 TATCTGGAAGTCCGGTCCTG Chr10:67468278..67468297 60.06 55
downstream ENSMUSE00000666221 Chr10:67468248..67468437 TATCTGGAAGTCCGGTCCTG Chr10:67468278..67468297 60.06 55
downstream ENSMUSE00000666220 Chr10:67476654..67476663 No primer for this exon
downstream ENSMUSE00000612265 Chr10:67480554..67480648 GGTATGAGCCAGCAAATGGT Chr10:67480587..67480606 59.96 50
downstream ENSMUSE00000666219 Chr10:67480556..67480648 GGTATGAGCCAGCAAATGGT Chr10:67480587..67480606 59.96 50
downstream ENSMUSE00000612264 Chr10:67488261..67488367 ACGTTGCCATACAAGGGAAG Chr10:67488300..67488319 59.99 50
downstream ENSMUSE00000289340 Chr10:67489266..67489397 CTTCCGGACCATAAAAGCAG Chr10:67489353..67489372 59.7 50
downstream ENSMUSE00000289329 Chr10:67498537..67498699 CAAAGAAATGTTGCCGGAAG Chr10:67498696..67498715 60.61 45
downstream ENSMUSE00000366897 Chr10:67502779..67502886 AAGGTGGTTTTCGTGGTGAC Chr10:67502847..67502866 59.87 50
downstream ENSMUSE00000441512 Chr10:67504127..67506612 ATGGGTTGGTCCGATCAATA Chr10:67506033..67506052 60.01 45
downstream ENSMUSE00000612263 Chr10:67504127..67504702 ATTCGCTCTACCCTGGGTTT Chr10:67504404..67504423 59.96 50
downstream ENSMUSE00000718667 Chr10:67504127..67506616 ATGGGTTGGTCCGATCAATA Chr10:67506033..67506052 60.01 45
downstream ENSMUSE00000721117 Chr10:67504127..67505046 ATTCGCTCTACCCTGGGTTT Chr10:67504404..67504423 59.96 50
downstream ENSMUSE00000666217 Chr10:67505261..67505352 AGGATTTCAGGGCTCATCAA Chr10:67505316..67505335 59.63 45
downstream ENSMUSE00000666216 Chr10:67520634..67521006 GACCATTGCTTCTGGTCACA Chr10:67520961..67520980 59.68 50
downstream ENSMUSE00000666215 Chr10:67521862..67521903 GGGCGATAGCAATCTTCCTT Chr10:67521893..67521912 60.55 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCGTGTGCAGAGTTATTCTC Chr10:67445571..67445592 59.9 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCTTGCACTGCTGAAC Chr10:67445513..67445533 61.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037846