Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20578
Trapped Gene
Cyb5b (ENSMUSG00000031924)
Vector Insertion
Chr 8: 109703343 - 109707477
Public Clones not available
Private Clones OST358200 (lexicon) OST199506 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214682 (Chr8:109703314..109703342 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214682 (Chr8:109703314..109703342 +)
Downstram Exon
ENSMUSE00000483036 (Chr8:109707478..109711370 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGCAACTGAATCTCACAGC Chr8:109710969..109710988 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353838 Chr8:109674540..109674773 GTCACCTACTACCGGCTGGA Chr8:109674669..109674688 60.13 60
upstream ENSMUSE00000214685 Chr8:109693711..109693839 CTTTGAAGATGTCGGCCACT Chr8:109693767..109693786 60.26 50
upstream ENSMUSE00000214684 Chr8:109694291..109694320 No primer for this exon
upstream ENSMUSE00000214682 Chr8:109703314..109703342 No primer for this exon

*** Putative Vector Insertion (Chr 8: 109703343 - 109707477) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000483036 Chr8:109707478..109711370 TGGCAACTGAATCTCACAGC Chr8:109710969..109710988 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:109706394..109706414 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTAAACTCTGGCGTGACT Chr8:109706380..109706401 58.99 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031924