Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20582
Trapped Gene
Itga9 (ENSMUSG00000039115)
Vector Insertion
Chr 9: 118716434 - 118741851
Public Clones not available
Private Clones OST358061 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000379199 (Chr9:118716283..118716433 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGCCAACGTGTCCTTTA Chr9:118716373..118716392 60.11 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000379199 (Chr9:118716283..118716433 +)
Downstram Exon
ENSMUSE00000271638 (Chr9:118741852..118741938 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGCCAACGTGTCCTTTA Chr9:118716373..118716392 60.11 45 GGAAATCCCACACTGCACTT Chr9:118741919..118741938 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000396297 Chr9:118515827..118516233 GAGCACTTCCACGACAACAC Chr9:118516208..118516227 59.31 55
upstream ENSMUSE00000347873 Chr9:118535566..118535693 GCACCGAAGGCAGATTCTAA Chr9:118535579..118535598 60.35 50
upstream ENSMUSE00000393911 Chr9:118537257..118537363 No primer for this exon
upstream ENSMUSE00000348460 Chr9:118545621..118545744 CCCATCGTTGGAAGAACATC Chr9:118545628..118545647 60.32 50
upstream ENSMUSE00000449613 Chr9:118561615..118561682 CGGAATAGCAGGCTTCTTCA Chr9:118561658..118561677 60.48 50
upstream ENSMUSE00000401364 Chr9:118567584..118567713 GTTTTATTGGGCTGGGACAC Chr9:118567613..118567632 59.29 50
upstream ENSMUSE00000353237 Chr9:118570466..118570551 ACAGGATGAAGGCATTGGAA Chr9:118570530..118570549 60.46 45
upstream ENSMUSE00000385327 Chr9:118572988..118573056 AGAGCTGACCGAAGATCAGG Chr9:118573000..118573019 59.56 55
upstream ENSMUSE00000467483 Chr9:118577730..118577867 CCGTCTACCTCAACCAAGGA Chr9:118577845..118577864 60.1 55
upstream ENSMUSE00000350361 Chr9:118580817..118580922 CTGACCCTGACTGGAGATGC Chr9:118580835..118580854 60.83 60
upstream ENSMUSE00000396224 Chr9:118581928..118582022 GGCACCTAAGGAGGAGGACT Chr9:118581941..118581960 59.7 60
upstream ENSMUSE00000390595 Chr9:118590054..118590144 GTCTGGGAGGAGGCTAAACC Chr9:118590059..118590078 60.07 60
upstream ENSMUSE00000350169 Chr9:118590853..118590898 No primer for this exon
upstream ENSMUSE00000384699 Chr9:118598388..118598542 GTGTCACGATGGACAACAGC Chr9:118598457..118598476 60.17 55
upstream ENSMUSE00000343874 Chr9:118607432..118607592 CCACATGGACGAAGTGTGTC Chr9:118607550..118607569 60.01 55
upstream ENSMUSE00000379721 Chr9:118678210..118678359 ATTGTGTTTGAAGCCGCCTA Chr9:118678237..118678256 60.64 45
upstream ENSMUSE00000346515 Chr9:118693220..118693296 TTGCCAATCTGAGGACTGTG Chr9:118693237..118693256 59.83 50
upstream ENSMUSE00000379199 Chr9:118716283..118716433 TGATGCCAACGTGTCCTTTA Chr9:118716373..118716392 60.11 45

*** Putative Vector Insertion (Chr 9: 118716434 - 118741851) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271638 Chr9:118741852..118741938 GGAAATCCCACACTGCACTT Chr9:118741919..118741938 59.97 50
downstream ENSMUSE00000271624 Chr9:118743414..118743493 CTGAGCAGTCACGATGAAGC Chr9:118743494..118743513 59.73 55
downstream ENSMUSE00000271604 Chr9:118750211..118750300 GACGTGTCCACTTCATGCAC Chr9:118750294..118750313 60.17 55
downstream ENSMUSE00000271583 Chr9:118752607..118752715 AGACTCGCCATACACGAAGG Chr9:118752646..118752665 60.28 55
downstream ENSMUSE00000271559 Chr9:118759817..118759924 GCTGGGACCCATGTTGTAGA Chr9:118759840..118759859 60.92 55
downstream ENSMUSE00000385100 Chr9:118778409..118778534 GGGGTCGGGTTTCTTTGTAG Chr9:118778458..118778477 60.71 55
downstream ENSMUSE00000344626 Chr9:118780939..118781058 CGGAAGAGCACTAAGGTTGC Chr9:118781001..118781020 60.01 55
downstream ENSMUSE00000382743 Chr9:118786240..118786341 GAGCCATGAACTGGATGACA Chr9:118786273..118786292 59.64 50
downstream ENSMUSE00000352694 Chr9:118796882..118797001 AGCAAACTGATGGCGATGAT Chr9:118796958..118796977 60.63 45
downstream ENSMUSE00000395328 Chr9:118806352..118808057 GCAACTGCTGAGAGGAAACC Chr9:118807202..118807221 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGATGGAGGGTGGGTGTTT Chr9:118722426..118722446 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATGGAGGGTGGGTGTTT Chr9:118722426..118722446 60.61 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039115