Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2059
Trapped Gene
Plekhc1 (ENSMUSG00000037712)
Vector Insertion
Chr 14: 46081916 - 46084398
Public Clones (sanger) AM0293 (sanger) YHC018 (baygenomics) IST15067B3 (tigm) IST15067B3 (tigm)
IST12376F1 (tigm)
Private Clones OST449144 (lexicon) OST434449 (lexicon) OST367279 (lexicon) OST112360 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314969 (Chr14:46084399..46084620 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATCCCTGACCAGATCACA Chr14:46084462..46084481 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314969 (Chr14:46084399..46084620 -)
Downstram Exon
ENSMUSE00000314959 (Chr14:46081791..46081915 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATCCCTGACCAGATCACA Chr14:46084462..46084481 60.05 50 GCCAGGCTTGAATGAATCTC Chr14:46081809..46081828 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453533 Chr14:46149611..46149713 No primer for this exon
upstream ENSMUSE00000706602 Chr14:46149609..46149793 No primer for this exon
upstream ENSMUSE00000408319 Chr14:46149100..46149266 GCTCTGGACGGGATAAGGAT Chr14:46149234..46149253 60.43 55
upstream ENSMUSE00000722177 Chr14:46149100..46149266 GCTCTGGACGGGATAAGGAT Chr14:46149234..46149253 60.43 55
upstream ENSMUSE00000315015 Chr14:46124172..46124405 TGGATAAGTGTGGCATCCAG Chr14:46124308..46124327 59.52 50
upstream ENSMUSE00000314890 Chr14:46102107..46102241 CCCAGAGATCCCACAAAGAA Chr14:46102184..46102203 60.04 50
upstream ENSMUSE00000314881 Chr14:46095563..46095788 ACCAACTTCTGCCTGGTTTG Chr14:46095690..46095709 60.15 50
upstream ENSMUSE00000315007 Chr14:46095248..46095350 TTGCTGCTCCGATTCAAGTA Chr14:46095276..46095295 59.57 45
upstream ENSMUSE00000314872 Chr14:46092447..46092554 AGAGATCGAATGCACGGAAG Chr14:46092476..46092495 60.36 50
upstream ENSMUSE00000314864 Chr14:46088915..46089049 GCCCTTTCTGACCTGGAGAT Chr14:46088949..46088968 60.6 55
upstream ENSMUSE00000314991 Chr14:46088178..46088227 TCAATCCCAGAACTTGCTGA Chr14:46088196..46088215 59.37 45
upstream ENSMUSE00000314985 Chr14:46087013..46087137 AGACACGTCCATCTCCTGCT Chr14:46087067..46087086 59.87 55
upstream ENSMUSE00000314978 Chr14:46084759..46084865 ATGAGATCTGGCTTCGCTGT Chr14:46084765..46084784 59.98 50
upstream ENSMUSE00000314969 Chr14:46084399..46084620 TGATCCCTGACCAGATCACA Chr14:46084462..46084481 60.05 50

*** Putative Vector Insertion (Chr 14: 46081916 - 46084398) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000314959 Chr14:46081791..46081915 GCCAGGCTTGAATGAATCTC Chr14:46081809..46081828 59.78 50
downstream ENSMUSE00000314950 Chr14:46081442..46081583 GTCCATCCGAATCAACCTGT Chr14:46081498..46081517 59.79 50
downstream ENSMUSE00000706596 Chr14:46079428..46079698 ATTTTGGTCTTTCGCACGAG Chr14:46079554..46079573 60.25 45
downstream ENSMUSE00000336558 Chr14:46078467..46079698 ATTTTGGTCTTTCGCACGAG Chr14:46079554..46079573 60.25 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATCCTGCCTAACCTGCT Chr14:46084373..46084393 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGCTCCTGCTTTACGTG Chr14:46084343..46084363 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCAGGTTAGCCTCCAAAGT Chr14:46084569..46084589 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCGTGTGCCTTCATCTCTC Chr14:46084646..46084666 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037712