Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20592
Trapped Gene
Pmm1 (ENSMUSG00000022474)
Vector Insertion
Chr 15: 81783231 - 81786078
Public Clones not available
Private Clones OST357777 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398536 (Chr15:81786079..81786178 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGGAGAGGATCGAGTTC Chr15:81786094..81786113 59.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398536 (Chr15:81786079..81786178 -)
Downstram Exon
ENSMUSE00000127325 (Chr15:81783155..81783230 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGGAGAGGATCGAGTTC Chr15:81786094..81786113 59.33 55 TTCTCCCGGATCTTCTCCTT Chr15:81783189..81783208 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394648 Chr15:81791145..81791294 CATCCTCTGCCTGTTTGACG Chr15:81791174..81791193 61.8 55
upstream ENSMUSE00000680688 Chr15:81788326..81788340 No primer for this exon
upstream ENSMUSE00000127320 Chr15:81788223..81788340 ACTCTAAGATCGCCGAGCAG Chr15:81788242..81788261 59.74 55
upstream ENSMUSE00000127321 Chr15:81786792..81786868 GGACGGCTACTCTCCAAACA Chr15:81786793..81786812 60.26 55
upstream ENSMUSE00000127330 Chr15:81786599..81786690 TTAGCTACATGGCCCTGCTC Chr15:81786616..81786635 60.37 55
upstream ENSMUSE00000398536 Chr15:81786079..81786178 TGGAGGAGAGGATCGAGTTC Chr15:81786094..81786113 59.33 55

*** Putative Vector Insertion (Chr 15: 81783231 - 81786078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127325 Chr15:81783155..81783230 TTCTCCCGGATCTTCTCCTT Chr15:81783189..81783208 60.15 50
downstream ENSMUSE00000127332 Chr15:81782354..81782469 TCCAGGCAGTAGCGCTTATC Chr15:81782390..81782409 60.51 55
downstream ENSMUSE00000484589 Chr15:81781542..81782042 GGGTCCGCATAGATCTCAAA Chr15:81781989..81782008 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCTCGGAACTGGACAAGG Chr15:81786076..81786096 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCTCGGAACTGGACAAGG Chr15:81786076..81786096 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022474