Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20609
Trapped Gene
Cpt1a (ENSMUSG00000024900)
Vector Insertion
Chr 19: 3323375 - 3349188
Public Clones P119F02 (ggtc) (ggtc) IST12308B12 (tigm) IST10787E1 (tigm) IST14452F6 (tigm)
IST11385G8 (tigm) IST12572E7 (tigm) IST10267G10 (tigm)
Private Clones OST357087 (lexicon) OST193056 (lexicon) OST66471 (lexicon) OST39623 (lexicon)
OST31042 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518400 (Chr19:3323348..3323374 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518400 (Chr19:3323348..3323374 +)
Downstram Exon
ENSMUSE00000334115 (Chr19:3349189..3349342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGGGGTGACTGTGAACTG Chr19:3349254..3349273 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518400 Chr19:3323348..3323374 No primer for this exon

*** Putative Vector Insertion (Chr 19: 3323375 - 3349188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334115 Chr19:3349189..3349342 TCAGGGGTGACTGTGAACTG Chr19:3349254..3349273 59.71 55
downstream ENSMUSE00000145992 Chr19:3352485..3352624 GGTGTCTAGGGTCCGATTGA Chr19:3352625..3352644 59.93 55
downstream ENSMUSE00000146005 Chr19:3356317..3356488 TCACGATGTTCTTCGTCTGG Chr19:3356354..3356373 59.83 50
downstream ENSMUSE00000145981 Chr19:3358176..3358277 CTTTCGACCCGAGAAGACCT Chr19:3358208..3358227 60.76 55
downstream ENSMUSE00000145966 Chr19:3362085..3362222 TGTCATGCGTTGGAAGTCTC Chr19:3362141..3362160 59.84 50
downstream ENSMUSE00000146000 Chr19:3364478..3364555 CCCCGCAGGTAGATGTATTC Chr19:3364518..3364537 59.41 55
downstream ENSMUSE00000145990 Chr19:3365675..3365782 TCTACCGTGCGACGATACAG Chr19:3365766..3365785 59.89 55
downstream ENSMUSE00000145977 Chr19:3366330..3366417 GGATGCGGGAAGTATTGAAG Chr19:3366405..3366424 59.53 50
downstream ENSMUSE00000146003 Chr19:3368855..3369050 CCTTGAAGTAACGGCCTCTG Chr19:3368923..3368942 59.87 55
downstream ENSMUSE00000146012 Chr19:3370707..3370895 TATCCCTGTTCCGATTCGTC Chr19:3370826..3370845 59.89 50
downstream ENSMUSE00000145987 Chr19:3371572..3371677 GGAATGCTCTGCGTTTATGC Chr19:3371644..3371663 60.75 50
downstream ENSMUSE00000145969 Chr19:3375093..3375209 TGTTGGGGTTCTTGTCTCCT Chr19:3375171..3375190 59.55 50
downstream ENSMUSE00000146010 Chr19:3376411..3376575 ACTGGCACTGCTTAGGGATG Chr19:3376452..3376471 60.28 55
downstream ENSMUSE00000237021 Chr19:3378368..3378502 GAAGAGCCGAGTCATGGAAG Chr19:3378421..3378440 59.95 55
downstream ENSMUSE00000145998 Chr19:3380017..3380169 AGGTGAGTCGACTGCCAGAT Chr19:3380160..3380179 59.87 55
downstream ENSMUSE00000146014 Chr19:3381610..3381723 ACAACCTCCATGGCTCAGAC Chr19:3381637..3381656 60.12 55
downstream ENSMUSE00000145968 Chr19:3381932..3382024 GGAAACACCATAGCCGTCAT Chr19:3381961..3381980 59.82 50
downstream ENSMUSE00000344530 Chr19:3383755..3384119 CCATTAGGAGCCGATTCAAA Chr19:3384099..3384118 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTACCACCATCCGTGAGTT Chr19:3338376..3338396 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTACCACCATCCGTGAGTT Chr19:3338376..3338396 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024900