Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20616
Trapped Gene
She (ENSMUSG00000046280)
Vector Insertion
Chr 3: 89636026 - 89638065
Public Clones not available
Private Clones OST356884 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000403332 (Chr3:89635292..89636025 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000403332 (Chr3:89635292..89636025 +)
Downstram Exon
ENSMUSE00000360671 (Chr3:89638066..89638192 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50 ATGTAGCCGTCGTTCTCACC Chr3:89638163..89638182 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403332 Chr3:89635292..89636025 AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50
upstream ENSMUSE00000672999 Chr3:89635426..89635487 CTGGGCCTCCTCACTCTTCT Chr3:89635467..89635486 60.92 60
upstream ENSMUSE00000672998 Chr3:89635944..89636025 AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50

*** Putative Vector Insertion (Chr 3: 89636026 - 89638065) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360671 Chr3:89638066..89638192 ATGTAGCCGTCGTTCTCACC Chr3:89638163..89638182 60.14 55
downstream ENSMUSE00000385627 Chr3:89653290..89653595 TCCCAGGGCTGTTCATACTC Chr3:89653563..89653582 60.07 55
downstream ENSMUSE00000350411 Chr3:89655531..89655672 GGTCGATCAGATCCCTCAAA Chr3:89655558..89655577 60.01 50
downstream ENSMUSE00000393714 Chr3:89656289..89656408 ACCAGGTAAGCGGCTTCTTT Chr3:89656366..89656385 60.26 50
downstream ENSMUSE00000348017 Chr3:89658453..89662758 AAGGCACCTGCATTACAACC Chr3:89662639..89662658 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGGACAAGGCCAAGATAA Chr3:89635990..89636010 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGGACAAGGCCAAGATAA Chr3:89635990..89636010 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046280