Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20626
Trapped Gene
Rpl24 (ENSMUSG00000022601)
Vector Insertion
Chr 16: 55966736 - 55967172
Public Clones not available
Private Clones OST356276 (lexicon) OST232888 (lexicon) OST232323 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000223023 (Chr16:55966660..55966735 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTTTCAGCGGGTACAAG Chr16:55966671..55966690 60.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000223023 (Chr16:55966660..55966735 +)
Downstram Exon
ENSMUSE00000128658 (Chr16:55967173..55967283 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTTTCAGCGGGTACAAG Chr16:55966671..55966690 60.83 55 ATCTGCCGAGGATTCCTTTT Chr16:55967240..55967259 60.04 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718751 Chr16:55966456..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000699413 Chr16:55966501..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000364485 Chr16:55966506..55966551 AGGCCGACATCTATCACCAT Chr16:55966529..55966548 59.39 50
upstream ENSMUSE00000223023 Chr16:55966660..55966735 GCAGTTTCAGCGGGTACAAG Chr16:55966671..55966690 60.83 55

*** Putative Vector Insertion (Chr 16: 55966736 - 55967172) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000128658 Chr16:55967173..55967283 ATCTGCCGAGGATTCCTTTT Chr16:55967240..55967259 60.04 45
downstream ENSMUSE00000128665 Chr16:55969623..55969759 GTGATGGCTCGTTGGAATTT Chr16:55969681..55969700 59.94 45
downstream ENSMUSE00000128661 Chr16:55970225..55970288 TGATGCCTGCTTAGCCTTTT Chr16:55970264..55970283 59.98 45
downstream ENSMUSE00000222998 Chr16:55971424..55971547 ACACTAGCGTTTCCCACCAA Chr16:55971510..55971529 60.55 50
downstream ENSMUSE00000713691 Chr16:55980708..55980834 TTTCCGAAGCATCCGATATT Chr16:55980803..55980822 59.51 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGATAATCGCCTTGCAG Chr16:55966781..55966801 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGGACGTGACTGGGAAA Chr16:55966780..55966800 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022601