Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20636
Trapped Gene
Bsn (ENSMUSG00000032589)
Vector Insertion
Chr 9: 108041927 - 108092374
Public Clones not available
Private Clones OST356076 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221208 (Chr9:108092375..108092714 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221208 (Chr9:108092375..108092714 -)
Downstram Exon
ENSMUSE00000221217 (Chr9:108041518..108041926 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTTGATGTGAGGTCCGAGGT Chr9:108041587..108041606 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221208 Chr9:108092375..108092714 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108041927 - 108092374) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221217 Chr9:108041518..108041926 GTTGATGTGAGGTCCGAGGT Chr9:108041587..108041606 59.97 55
downstream ENSMUSE00000245702 Chr9:108028021..108028911 AGGAGATCGCTCTTGCTCTG Chr9:108028722..108028741 59.85 55
downstream ENSMUSE00000221212 Chr9:108019381..108019890 TGGAACAGGCTTGACAACTG Chr9:108019386..108019405 59.87 50
downstream ENSMUSE00000469753 Chr9:108012216..108018857 TCCTACTACCCCCTGTGTGC Chr9:108014960..108014979 59.99 60
downstream ENSMUSE00000245611 Chr9:108008441..108010517 TTCGTCAGTTCGCTGATGTC Chr9:108009411..108009430 59.99 50
downstream ENSMUSE00000221209 Chr9:108007331..108008139 GGGCTCATCGTAGTCATGGT Chr9:108007969..108007988 59.96 55
downstream ENSMUSE00000221214 Chr9:108007117..108007219 CAGGTCCTGGAGTTGTCTGC Chr9:108007104..108007123 60.86 60
downstream ENSMUSE00000350227 Chr9:108006275..108006406 CCCACCAGGGAGGATCTTAG Chr9:108006284..108006303 60.83 60
downstream ENSMUSE00000221207 Chr9:108005995..108006049 CCTTCTGGACACAATCACCA Chr9:108005973..108005992 59.52 50
downstream ENSMUSE00000221223 Chr9:108005521..108005613 CAGGCCTTTGACTCCAGAGA Chr9:108005527..108005546 60.52 55
downstream ENSMUSE00000245770 Chr9:107998354..108002228 ACTTTAGGGGTCAGGCAGGT Chr9:107999798..107999817 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCATACCCAGGGCCTAAT Chr9:108053319..108053339 60.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr9:108053307..108053327 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032589