Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20638
Trapped Gene
Clic1 (ENSMUSG00000007041)
Vector Insertion
Chr 17: 35187432 - 35189379
Public Clones (ggtc) (ggtc) IST14732B9 (tigm) IST14091D5 (tigm) IST14742F2 (tigm)
Private Clones OST356045 (lexicon) OST302887 (lexicon) OST276129 (lexicon) OST132584 (lexicon)
OST60159 (lexicon) OST13630 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657459 (Chr17:35187377..35187431 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657459 (Chr17:35187377..35187431 +)
Downstram Exon
ENSMUSE00000280443 (Chr17:35189380..35189489 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657459 Chr17:35187377..35187431 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35187432 - 35189379) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000280443 Chr17:35189380..35189489 No primer for this exon
downstream ENSMUSE00000141732 Chr17:35189726..35189851 No primer for this exon
downstream ENSMUSE00000141728 Chr17:35189978..35190084 No primer for this exon
downstream ENSMUSE00000141727 Chr17:35192172..35192353 No primer for this exon
downstream ENSMUSE00000336518 Chr17:35195275..35195665 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCACTCTCAGGATTTCT Chr17:35187455..35187475 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCCACTCTCAGGATTTCT Chr17:35187455..35187475 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007041