Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20643
Trapped Gene
Wasf1 (ENSMUSG00000019831)
Vector Insertion
Chr 10: 40640053 - 40640215
Public Clones not available
Private Clones OST355961 (lexicon) OST307619 (lexicon) OST261407 (lexicon) OST253040 (lexicon)
OST253039 (lexicon) OST253029 (lexicon) OST253028 (lexicon) OST253025 (lexicon)
OST253016 (lexicon) OST253009 (lexicon) OST253008 (lexicon) OST253007 (lexicon)
OST253002 (lexicon) OST253000 (lexicon) OST252999 (lexicon) OST252997 (lexicon)
OST252996 (lexicon) OST252991 (lexicon) OST252990 (lexicon) OST252987 (lexicon)
OST252985 (lexicon) OST252984 (lexicon) OST252979 (lexicon) OST252977 (lexicon)
OST252976 (lexicon) OST252973 (lexicon) OST252572 (lexicon) OST244053 (lexicon)
OST238141 (lexicon) OST171620 (lexicon) OST144129 (lexicon) OST66260 (lexicon)
OST33757 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398335 (Chr10:40640054..40640214 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398335 (Chr10:40640054..40640214 +)
Downstram Exon
ENSMUSE00000713337 (Chr10:40640054..40640214 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644055 Chr10:40603379..40603415 No primer for this exon
upstream ENSMUSE00000666475 Chr10:40603633..40603876 No primer for this exon

*** Putative Vector Insertion (Chr 10: 40640053 - 40640215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398335 Chr10:40640054..40640214 No primer for this exon
downstream ENSMUSE00000713337 Chr10:40640054..40640214 No primer for this exon
downstream ENSMUSE00000098383 Chr10:40646290..40646424 No primer for this exon
downstream ENSMUSE00000299241 Chr10:40650437..40650590 No primer for this exon
downstream ENSMUSE00000299233 Chr10:40651722..40651839 No primer for this exon
downstream ENSMUSE00000299224 Chr10:40652919..40653091 No primer for this exon
downstream ENSMUSE00000299218 Chr10:40654283..40654462 No primer for this exon
downstream ENSMUSE00000098386 Chr10:40655916..40656544 No primer for this exon
downstream ENSMUSE00000406624 Chr10:40657452..40658373 No primer for this exon
downstream ENSMUSE00000666474 Chr10:40657452..40658376 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGATGCCGTTGGTGAAAAG Chr10:40640080..40640100 60.11 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGATGCCGTTGGTGAAAAG Chr10:40640080..40640100 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019831