Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20647
Trapped Gene
Rrp1b (ENSMUSG00000058392)
Vector Insertion
Chr 17: 32173550 - 32182873
Public Clones PST21432-NL (escells)
Private Clones OST355810 (lexicon) OST178511 (lexicon) OST41159 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000547752 (Chr17:32173107..32173549 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAACTAACCGCCCTGTCAAT Chr17:32173189..32173208 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000547752 (Chr17:32173107..32173549 +)
Downstram Exon
ENSMUSE00000313039 (Chr17:32182874..32182956 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAACTAACCGCCCTGTCAAT Chr17:32173189..32173208 59.99 50 GCACCCACATGCAGTAGAAG Chr17:32182939..32182958 59.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000547752 Chr17:32173107..32173549 CAACTAACCGCCCTGTCAAT Chr17:32173189..32173208 59.99 50

*** Putative Vector Insertion (Chr 17: 32173550 - 32182873) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313039 Chr17:32182874..32182956 GCACCCACATGCAGTAGAAG Chr17:32182939..32182958 59.32 55
downstream ENSMUSE00000313011 Chr17:32184619..32184676 AACGTGGATGAGTTGGGAAA Chr17:32184660..32184679 60.35 45
downstream ENSMUSE00000547741 Chr17:32185498..32185583 CCTTGCCACTCTCGATTCAT Chr17:32185552..32185571 60.22 50
downstream ENSMUSE00000312955 Chr17:32186371..32186432 CCGCTTGAGAACTTCAAAGG Chr17:32186418..32186437 59.99 50
downstream ENSMUSE00000312926 Chr17:32186894..32187023 CCCACTGTGGTAAGCTCCTC Chr17:32187016..32187035 59.72 60
downstream ENSMUSE00000312898 Chr17:32188091..32188155 TGAGGTTCTGGTCCGCTAAG Chr17:32188115..32188134 60.39 55
downstream ENSMUSE00000312877 Chr17:32188628..32188794 TCAAAAACACCCCTCGCTAC Chr17:32188669..32188688 60.11 50
downstream ENSMUSE00000312854 Chr17:32189684..32189772 CTGCCAATGACTCCGTCTCT Chr17:32189723..32189742 60.41 55
downstream ENSMUSE00000137510 Chr17:32190802..32190899 AGTCTGCAGAGTCGCTTCCT Chr17:32190893..32190912 59.35 55
downstream ENSMUSE00000479782 Chr17:32192050..32192069 No primer for this exon
downstream ENSMUSE00000137513 Chr17:32192856..32192942 GTGCCTTCTCTGACCGTTGT Chr17:32192908..32192927 60.31 55
downstream ENSMUSE00000312778 Chr17:32193501..32194201 TCTCCGAATCCGGTACTTTG Chr17:32193647..32193666 60.07 50
downstream ENSMUSE00000312759 Chr17:32195469..32195609 CACAAAGTCGTCCTCCGTTT Chr17:32195522..32195541 60.15 50
downstream ENSMUSE00000312742 Chr17:32196219..32196282 TCTTGGAACTGGAGGGTGTT Chr17:32196249..32196268 59.55 50
downstream ENSMUSE00000609261 Chr17:32197293..32197547 GGGGCTGACCAGGATACTCT Chr17:32197333..32197352 60.48 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr17:32176599..32176619 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGGGATAAATGGGAACAGTC Chr17:32176558..32176580 59.22 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058392