Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20653
Trapped Gene
8430427H17Rik (ENSMUSG00000061411)
Vector Insertion
Chr 2: 153296534 - 153303606
Public Clones not available
Private Clones OST355687 (lexicon) OST232240 (lexicon) OST214893 (lexicon) OST194886 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000276516 (Chr2:153303607..153303718 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGGCTGTGACTCGGTTC Chr2:153303671..153303690 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000276516 (Chr2:153303607..153303718 -)
Downstram Exon
ENSMUSE00000276509 (Chr2:153296424..153296533 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGGCTGTGACTCGGTTC Chr2:153303671..153303690 59.99 60 TGAGGGGCATGTTGTAATCA Chr2:153296455..153296474 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000555729 Chr2:153355178..153355709 CGACTCGGCTAAAACCAAGA Chr2:153355372..153355391 60.38 50
upstream ENSMUSE00000504458 Chr2:153309423..153309578 CTACTCGATGCACGTGGAGA Chr2:153309482..153309501 60.01 55
upstream ENSMUSE00000276516 Chr2:153303607..153303718 GAGAGGCTGTGACTCGGTTC Chr2:153303671..153303690 59.99 60

*** Putative Vector Insertion (Chr 2: 153296534 - 153303606) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000276509 Chr2:153296424..153296533 TGAGGGGCATGTTGTAATCA Chr2:153296455..153296474 59.92 45
downstream ENSMUSE00000681596 Chr2:153270093..153270215 GGCGATCTAGCTCTGGGAGT Chr2:153270096..153270115 60.89 60
downstream ENSMUSE00000276502 Chr2:153261942..153262083 TCCATGCGGAGTCATTCATA Chr2:153262010..153262029 60.03 45
downstream ENSMUSE00000460716 Chr2:153246268..153246545 GTGGATGGGTTCAGGGTAGA Chr2:153246466..153246485 59.78 55
downstream ENSMUSE00000461586 Chr2:153243696..153243881 ATCGTCATCGTCATCTGCTG Chr2:153243752..153243771 59.82 50
downstream ENSMUSE00000471602 Chr2:153243424..153243615 GGTTCTCATCCACGAAGAGC Chr2:153243563..153243582 59.81 55
downstream ENSMUSE00000463499 Chr2:153243099..153243221 AGGTCAGATGCGGAGGAGTA Chr2:153243172..153243191 59.83 55
downstream ENSMUSE00000384147 Chr2:153242380..153242581 AGTCCCGAGAGTGCTGCTTA Chr2:153242520..153242539 60.16 55
downstream ENSMUSE00000466561 Chr2:153233202..153237565 CAGACAGAATGCGGTAAGCA Chr2:153235321..153235340 60.01 50
downstream ENSMUSE00000681598 Chr2:153233198..153237565 CAGACAGAATGCGGTAAGCA Chr2:153235321..153235340 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGTGGGTGGTGGCTAATC Chr2:153300550..153300570 61.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTGACCCATAAATCCCATC Chr2:153300573..153300595 60.02 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061411