Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20663
Trapped Gene
Usp40 (ENSMUSG00000005501)
Vector Insertion
Chr 1: 89904018 - 89905012
Public Clones not available
Private Clones OST355437 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694532 (Chr1:89905013..89905109 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694532 (Chr1:89905013..89905109 -)
Downstram Exon
ENSMUSE00000403143 (Chr1:89903800..89904017 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466582 Chr1:89905013..89905126 No primer for this exon
upstream ENSMUSE00000694532 Chr1:89905013..89905109 No primer for this exon

*** Putative Vector Insertion (Chr 1: 89904018 - 89905012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403143 Chr1:89903800..89904017 No primer for this exon
downstream ENSMUSE00000391480 Chr1:89900822..89900889 No primer for this exon
downstream ENSMUSE00000332624 Chr1:89898984..89899097 No primer for this exon
downstream ENSMUSE00000363096 Chr1:89896315..89896479 No primer for this exon
downstream ENSMUSE00000323596 Chr1:89894388..89894534 No primer for this exon
downstream ENSMUSE00000323588 Chr1:89892286..89892429 No primer for this exon
downstream ENSMUSE00000157666 Chr1:89890749..89890877 No primer for this exon
downstream ENSMUSE00000157658 Chr1:89886637..89886732 No primer for this exon
downstream ENSMUSE00000157663 Chr1:89885460..89885567 No primer for this exon
downstream ENSMUSE00000157648 Chr1:89882477..89882774 No primer for this exon
downstream ENSMUSE00000157668 Chr1:89880329..89880410 No primer for this exon
downstream ENSMUSE00000323726 Chr1:89878584..89878755 No primer for this exon
downstream ENSMUSE00000157665 Chr1:89877546..89877630 No primer for this exon
downstream ENSMUSE00000157652 Chr1:89876590..89876660 No primer for this exon
downstream ENSMUSE00000157653 Chr1:89874886..89875208 No primer for this exon
downstream ENSMUSE00000157664 Chr1:89872383..89872506 No primer for this exon
downstream ENSMUSE00000157646 Chr1:89870652..89870709 No primer for this exon
downstream ENSMUSE00000694531 Chr1:89864971..89865024 No primer for this exon
downstream ENSMUSE00000694523 Chr1:89864085..89864173 No primer for this exon
downstream ENSMUSE00000694520 Chr1:89863759..89863845 No primer for this exon
downstream ENSMUSE00000694519 Chr1:89861881..89861917 No primer for this exon
downstream ENSMUSE00000157645 Chr1:89858999..89859063 No primer for this exon
downstream ENSMUSE00000157659 Chr1:89856364..89856438 No primer for this exon
downstream ENSMUSE00000157667 Chr1:89853786..89853909 No primer for this exon
downstream ENSMUSE00000157654 Chr1:89850726..89850820 No primer for this exon
downstream ENSMUSE00000157649 Chr1:89848915..89849033 No primer for this exon
downstream ENSMUSE00000157650 Chr1:89848218..89848283 No primer for this exon
downstream ENSMUSE00000381734 Chr1:89846734..89846944 No primer for this exon
downstream ENSMUSE00000659903 Chr1:89846507..89846602 No primer for this exon
downstream ENSMUSE00000659902 Chr1:89845077..89845171 No primer for this exon
downstream ENSMUSE00000694518 Chr1:89843018..89843282 No primer for this exon
downstream ENSMUSE00000659901 Chr1:89841696..89843282 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr1:89904942..89904962 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGGCGTGACTGGGAAAAC Chr1:89904946..89904966 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005501