Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20666
Trapped Gene
Elavl4 (ENSMUSG00000028546)
Vector Insertion
Chr 4: 109924127 - 109924297
Public Clones not available
Private Clones OST355228 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670592 (Chr4:109924298..109924318 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGGGCTGGTCTAAAAAT Chr4:109924299..109924318 58.19 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670592 (Chr4:109924298..109924318 -)
Downstram Exon
ENSMUSE00000715302 (Chr4:109923886..109924126 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGGGCTGGTCTAAAAAT Chr4:109924299..109924318 58.19 45 TTGTATTGGATGTCGGTCCA Chr4:109924053..109924072 59.77 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670613 Chr4:110024402..110024419 No primer for this exon
upstream ENSMUSE00000670606 Chr4:109965240..109965327 GTGTTGCACGTGAATGCTCT Chr4:109965291..109965310 59.91 50
upstream ENSMUSE00000670591 Chr4:109963239..109963286 CAGGACGCTTAATGCTGCTT Chr4:109963253..109963272 60.54 50
upstream ENSMUSE00000670602 Chr4:109962766..109962825 No primer for this exon
upstream ENSMUSE00000662410 Chr4:109959838..109960132 CATCCTAGAATCGGGGGTTT Chr4:109960072..109960091 60.15 50
upstream ENSMUSE00000670601 Chr4:109959838..109960106 CATCCTAGAATCGGGGGTTT Chr4:109960072..109960091 60.15 50
upstream ENSMUSE00000662408 Chr4:109959075..109959494 GAACGTTGAGATGGGCAGTT Chr4:109959362..109959381 60.12 50
upstream ENSMUSE00000705685 Chr4:109959075..109959098 GAGTGGAATGGCTTGAAGATG Chr4:109959075..109959095 59.69 47.62
upstream ENSMUSE00000670594 Chr4:109924540..109924545 No primer for this exon
upstream ENSMUSE00000670593 Chr4:109924462..109924470 No primer for this exon
upstream ENSMUSE00000670592 Chr4:109924298..109924318 CAAGGGGCTGGTCTAAAAAT Chr4:109924299..109924318 58.19 45

*** Putative Vector Insertion (Chr 4: 109924127 - 109924297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000715302 Chr4:109923886..109924126 TTGTATTGGATGTCGGTCCA Chr4:109924053..109924072 59.77 45
downstream ENSMUSE00000719891 Chr4:109923886..109924126 TTGTATTGGATGTCGGTCCA Chr4:109924053..109924072 59.77 45
downstream ENSMUSE00000266739 Chr4:109899150..109899253 GATGGCTTTCTCTGCATCCT Chr4:109899170..109899189 59.39 50
downstream ENSMUSE00000670589 Chr4:109899150..109899253 GATGGCTTTCTCTGCATCCT Chr4:109899170..109899189 59.39 50
downstream ENSMUSE00000509303 Chr4:109885733..109885886 GTGATGATGCGACCGTATTG Chr4:109885740..109885759 59.96 50
downstream ENSMUSE00000670586 Chr4:109885733..109885886 GTGATGATGCGACCGTATTG Chr4:109885740..109885759 59.96 50
downstream ENSMUSE00000180022 Chr4:109884031..109884256 AATCTTTGAGCCTGGTGGTG Chr4:109884012..109884031 60.11 50
downstream ENSMUSE00000670585 Chr4:109884031..109884256 AATCTTTGAGCCTGGTGGTG Chr4:109884012..109884031 60.11 50
downstream ENSMUSE00000180023 Chr4:109882345..109882383 CGCCATAGGCCATATTAAGC Chr4:109882330..109882349 59.57 50
downstream ENSMUSE00000670584 Chr4:109882345..109882383 CGCCATAGGCCATATTAAGC Chr4:109882330..109882349 59.57 50
downstream ENSMUSE00000662409 Chr4:109878558..109879306 AGGGATGTTCATTCCCACAA Chr4:109879188..109879207 60.17 45
downstream ENSMUSE00000670582 Chr4:109878558..109879306 AGGGATGTTCATTCCCACAA Chr4:109879188..109879207 60.17 45
downstream ENSMUSE00000670607 Chr4:109877099..109879264 CGTAGTTGGTCATGGTGACG Chr4:109879013..109879032 60.03 55
downstream ENSMUSE00000670605 Chr4:109876342..109879264 CGTAGTTGGTCATGGTGACG Chr4:109879013..109879032 60.03 55
downstream ENSMUSE00000670599 Chr4:109876327..109879264 CGTAGTTGGTCATGGTGACG Chr4:109879013..109879032 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGGGGCTGGTCTAAAAAT Chr4:109924297..109924318 59.95 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAAATTGGCTGCGTGACTG Chr4:109924238..109924258 59.49 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028546