Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20669
Trapped Gene
Actr3 (ENSMUSG00000026341)
Vector Insertion
Chr 1: 127312958 - 127314825
Public Clones not available
Private Clones OST355181 (lexicon) OST99328 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322402 (Chr1:127314826..127314881 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGAAATACAGAGCCACAG Chr1:127314842..127314862 59.89 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322402 (Chr1:127314826..127314881 -)
Downstram Exon
ENSMUSE00000158207 (Chr1:127312833..127312957 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGAAATACAGAGCCACAG Chr1:127314842..127314862 59.89 52.38 TCTAGGTCATCCACGCCTTT Chr1:127312860..127312879 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000322410 Chr1:127331862..127332082 TCAGCCAGCTCCCATCTCTA Chr1:127331961..127331980 61.05 55
upstream ENSMUSE00000322402 Chr1:127314826..127314881 GCTGGAAATACAGAGCCACAG Chr1:127314842..127314862 59.89 52.38

*** Putative Vector Insertion (Chr 1: 127312958 - 127314825) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158207 Chr1:127312833..127312957 TCTAGGTCATCCACGCCTTT Chr1:127312860..127312879 59.69 50
downstream ENSMUSE00000540219 Chr1:127307841..127307951 CACTTGCTCCATAAACCTTTCC Chr1:127307867..127307888 60 45.46
downstream ENSMUSE00000540214 Chr1:127305097..127305192 GCCTGGAACATTGAAGGATT Chr1:127305093..127305112 58.98 45
downstream ENSMUSE00000540213 Chr1:127303869..127303976 AGGATGCAGCTAAGGCAAGA Chr1:127303930..127303949 60.12 50
downstream ENSMUSE00000540210 Chr1:127302422..127302565 CTTTCGCAGTTTCCAAGGAC Chr1:127302408..127302427 59.85 50
downstream ENSMUSE00000158204 Chr1:127299970..127300143 AGGAATCGCTCATAGCCAAC Chr1:127299976..127299995 59.3 50
downstream ENSMUSE00000158201 Chr1:127294029..127294121 ACATCAATGGGGCAATTCTG Chr1:127294026..127294045 60.72 45
downstream ENSMUSE00000322348 Chr1:127293684..127293809 ACCACTCAGCTCCTCGCTTA Chr1:127293674..127293693 60.16 55
downstream ENSMUSE00000322344 Chr1:127291645..127291728 TACCGCTGCATATGGTGTGT Chr1:127291660..127291679 60.02 50
downstream ENSMUSE00000322336 Chr1:127289486..127290667 ATCGGCTAACCCAGGAGACT Chr1:127289975..127289994 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:127314755..127314775 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTTCCTCACGTGACTGG Chr1:127314765..127314785 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026341