Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20677
Trapped Gene
Zfp35 (ENSMUSG00000063281)
Vector Insertion
Chr 18: 24148233 - 24148678
Public Clones not available
Private Clones OST355011 (lexicon) OST292786 (lexicon) OST167756 (lexicon) OST131192 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000572975 (Chr18:24148182..24148232 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000572975 (Chr18:24148182..24148232 +)
Downstram Exon
ENSMUSE00000572974 (Chr18:24148679..24148891 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATAGGGCACAACTGGACACC Chr18:24148847..24148866 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000572975 Chr18:24148182..24148232 No primer for this exon

*** Putative Vector Insertion (Chr 18: 24148233 - 24148678) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000572974 Chr18:24148679..24148891 ATAGGGCACAACTGGACACC Chr18:24148847..24148866 59.85 55
downstream ENSMUSE00000494905 Chr18:24161151..24163230 AACCGCGACTGAAGCTTTTA Chr18:24162377..24162396 60.02 45
downstream ENSMUSE00000582915 Chr18:24161417..24161621 CCTTGCCACACTCATCACAC Chr18:24161606..24161625 60.16 55
downstream ENSMUSE00000704300 Chr18:24162126..24162186 CGGTGTGAATTCGTTGATGA Chr18:24162158..24162177 60.52 45
downstream ENSMUSE00000704299 Chr18:24162439..24162499 CCCAGAATGCACTCTCTGATGT Chr18:24162494..24162515 61.61 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCCTAGTGTTCTGTGGA Chr18:24148242..24148262 59.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCCTAGTGTTCTGTGGA Chr18:24148242..24148262 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063281