Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20690
Trapped Gene
Gsta1 (ENSMUSG00000074183)
Vector Insertion
Chr 9: 78078538 - 78080024
Public Clones not available
Private Clones OST354814 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635394 (Chr9:78078481..78078537 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGACTGTGAGCTGAGTG Chr9:78078493..78078512 59.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635394 (Chr9:78078481..78078537 +)
Downstram Exon
ENSMUSE00000635393 (Chr9:78080025..78080133 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGACTGTGAGCTGAGTG Chr9:78078493..78078512 59.76 60 CATTGCAGCAACTGTGGTTC Chr9:78080052..78080071 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635394 Chr9:78078481..78078537 GCTGGACTGTGAGCTGAGTG Chr9:78078493..78078512 59.76 60

*** Putative Vector Insertion (Chr 9: 78078538 - 78080024) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635393 Chr9:78080025..78080133 CATTGCAGCAACTGTGGTTC Chr9:78080052..78080071 60.31 50
downstream ENSMUSE00000635392 Chr9:78082891..78082942 TCCAAATCTTCCGGACTCTG Chr9:78082931..78082950 60.19 50
downstream ENSMUSE00000635391 Chr9:78083737..78083869 TGGTGGCGATGTAGTTGAGA Chr9:78083832..78083851 60.26 50
downstream ENSMUSE00000635390 Chr9:78087292..78087433 CAAGGCAGTCTTGGCTTCTC Chr9:78087391..78087410 60.13 55
downstream ENSMUSE00000635389 Chr9:78089334..78089465 CCTGTTGCCCACAAGGTAGT Chr9:78089378..78089397 60.03 55
downstream ENSMUSE00000635388 Chr9:78090260..78090489 GAGGCTGCTGATTCTGCTCT Chr9:78090289..78090308 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGGAGAAGAAGCCAGGA Chr9:78078509..78078529 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTGGAGAAGAAGCCAGGA Chr9:78078509..78078529 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074183