Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20704
Trapped Gene
Map1lc3b (ENSMUSG00000031812)
Vector Insertion
Chr 8: 124119993 - 124120495
Public Clones not available
Private Clones OST354157 (lexicon) OST145918 (lexicon) OST102264 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487435 (Chr8:124119886..124119992 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGATACAAGGGGGAGAAG Chr8:124119896..124119915 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487435 (Chr8:124119886..124119992 +)
Downstram Exon
ENSMUSE00000476335 (Chr8:124120496..124121946 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGATACAAGGGGGAGAAG Chr8:124119896..124119915 60.59 55 GCTTAAGCTGGGTCAGCAAC Chr8:124121285..124121304 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462223 Chr8:124114377..124114464 GTCCGAGAAGACCTTCAAGC Chr8:124114430..124114449 59.02 55
upstream ENSMUSE00000521424 Chr8:124117390..124117445 No primer for this exon
upstream ENSMUSE00000487435 Chr8:124119886..124119992 AGCGATACAAGGGGGAGAAG Chr8:124119896..124119915 60.59 55

*** Putative Vector Insertion (Chr 8: 124119993 - 124120495) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000476335 Chr8:124120496..124121946 GCTTAAGCTGGGTCAGCAAC Chr8:124121285..124121304 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGACCACGTGAACATGAGC Chr8:124119954..124119974 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGACCACGTGAACATGAGC Chr8:124119954..124119974 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031812