Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20705
Trapped Gene
Dock2 (ENSMUSG00000020143)
Vector Insertion
Chr 11: 34403415 - 34414427
Public Clones not available
Private Clones OST354142 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249670 (Chr11:34414428..34414536 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249670 (Chr11:34414428..34414536 -)
Downstram Exon
ENSMUSE00000249660 (Chr11:34403344..34403414 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679911 Chr11:34597283..34597325 No primer for this exon
upstream ENSMUSE00000679913 Chr11:34597283..34597394 No primer for this exon
upstream ENSMUSE00000679923 Chr11:34597283..34597325 No primer for this exon
upstream ENSMUSE00000580333 Chr11:34569701..34569784 No primer for this exon
upstream ENSMUSE00000654470 Chr11:34569701..34569784 No primer for this exon
upstream ENSMUSE00000580332 Chr11:34546933..34546973 No primer for this exon
upstream ENSMUSE00000654469 Chr11:34546933..34546973 No primer for this exon
upstream ENSMUSE00000580331 Chr11:34545843..34545898 No primer for this exon
upstream ENSMUSE00000654468 Chr11:34545843..34545898 No primer for this exon
upstream ENSMUSE00000580330 Chr11:34544992..34545088 No primer for this exon
upstream ENSMUSE00000654467 Chr11:34544992..34545088 No primer for this exon
upstream ENSMUSE00000580329 Chr11:34540820..34540968 No primer for this exon
upstream ENSMUSE00000654466 Chr11:34540820..34540968 No primer for this exon
upstream ENSMUSE00000580328 Chr11:34534431..34534566 No primer for this exon
upstream ENSMUSE00000654465 Chr11:34534431..34534566 No primer for this exon
upstream ENSMUSE00000654462 Chr11:34532353..34532507 No primer for this exon
upstream ENSMUSE00000654464 Chr11:34532353..34532507 No primer for this exon
upstream ENSMUSE00000580326 Chr11:34527950..34528031 No primer for this exon
upstream ENSMUSE00000654461 Chr11:34527950..34528031 No primer for this exon
upstream ENSMUSE00000580325 Chr11:34522274..34522409 No primer for this exon
upstream ENSMUSE00000654460 Chr11:34522274..34522409 No primer for this exon
upstream ENSMUSE00000580324 Chr11:34520790..34520865 No primer for this exon
upstream ENSMUSE00000654459 Chr11:34520790..34520865 No primer for this exon
upstream ENSMUSE00000580323 Chr11:34519939..34520015 No primer for this exon
upstream ENSMUSE00000654458 Chr11:34519939..34520015 No primer for this exon
upstream ENSMUSE00000580322 Chr11:34519272..34519397 No primer for this exon
upstream ENSMUSE00000654456 Chr11:34519272..34519397 No primer for this exon
upstream ENSMUSE00000580321 Chr11:34518087..34518211 No primer for this exon
upstream ENSMUSE00000654455 Chr11:34518087..34518211 No primer for this exon
upstream ENSMUSE00000580320 Chr11:34512249..34512347 No primer for this exon
upstream ENSMUSE00000654453 Chr11:34512249..34512347 No primer for this exon
upstream ENSMUSE00000580319 Chr11:34508931..34509003 No primer for this exon
upstream ENSMUSE00000654452 Chr11:34508931..34509003 No primer for this exon
upstream ENSMUSE00000580318 Chr11:34508697..34508800 No primer for this exon
upstream ENSMUSE00000654451 Chr11:34508697..34508800 No primer for this exon
upstream ENSMUSE00000580317 Chr11:34505744..34505927 No primer for this exon
upstream ENSMUSE00000654450 Chr11:34505744..34505927 No primer for this exon
upstream ENSMUSE00000580316 Chr11:34505388..34505485 No primer for this exon
upstream ENSMUSE00000654449 Chr11:34505388..34505485 No primer for this exon
upstream ENSMUSE00000580315 Chr11:34503213..34503302 No primer for this exon
upstream ENSMUSE00000654448 Chr11:34503213..34503302 No primer for this exon
upstream ENSMUSE00000580314 Chr11:34501955..34502055 No primer for this exon
upstream ENSMUSE00000654447 Chr11:34501955..34502055 No primer for this exon
upstream ENSMUSE00000580313 Chr11:34501010..34501144 No primer for this exon
upstream ENSMUSE00000654446 Chr11:34501010..34501144 No primer for this exon
upstream ENSMUSE00000249670 Chr11:34414428..34414536 No primer for this exon

*** Putative Vector Insertion (Chr 11: 34403415 - 34414427) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249660 Chr11:34403344..34403414 No primer for this exon
downstream ENSMUSE00000101112 Chr11:34401170..34401276 No primer for this exon
downstream ENSMUSE00000580312 Chr11:34364813..34364958 No primer for this exon
downstream ENSMUSE00000580311 Chr11:34338275..34338370 No primer for this exon
downstream ENSMUSE00000654445 Chr11:34263863..34263917 No primer for this exon
downstream ENSMUSE00000654444 Chr11:34262653..34262828 No primer for this exon
downstream ENSMUSE00000380704 Chr11:34212459..34212557 No primer for this exon
downstream ENSMUSE00000580310 Chr11:34210350..34210444 No primer for this exon
downstream ENSMUSE00000376886 Chr11:34200487..34200565 No primer for this exon
downstream ENSMUSE00000331282 Chr11:34194259..34194359 No primer for this exon
downstream ENSMUSE00000375316 Chr11:34194110..34194168 No primer for this exon
downstream ENSMUSE00000405206 Chr11:34182621..34182769 No primer for this exon
downstream ENSMUSE00000373196 Chr11:34173669..34173754 No primer for this exon
downstream ENSMUSE00000654463 Chr11:34173045..34173296 No primer for this exon
downstream ENSMUSE00000348499 Chr11:34167948..34168104 No primer for this exon
downstream ENSMUSE00000391673 Chr11:34166241..34166281 No primer for this exon
downstream ENSMUSE00000342677 Chr11:34162387..34162477 No primer for this exon
downstream ENSMUSE00000393729 Chr11:34161433..34161552 No primer for this exon
downstream ENSMUSE00000351317 Chr11:34158084..34158173 No primer for this exon
downstream ENSMUSE00000391833 Chr11:34156527..34156631 No primer for this exon
downstream ENSMUSE00000348688 Chr11:34154331..34154472 No primer for this exon
downstream ENSMUSE00000360807 Chr11:34149757..34149838 No primer for this exon
downstream ENSMUSE00000376674 Chr11:34148574..34148658 No primer for this exon
downstream ENSMUSE00000364508 Chr11:34147775..34147861 No primer for this exon
downstream ENSMUSE00000405120 Chr11:34139529..34139705 No primer for this exon
downstream ENSMUSE00000362700 Chr11:34138150..34138233 No primer for this exon
downstream ENSMUSE00000402002 Chr11:34132769..34132906 No primer for this exon
downstream ENSMUSE00000357998 Chr11:34131571..34131698 No primer for this exon
downstream ENSMUSE00000399275 Chr11:34130656..34130824 No primer for this exon
downstream ENSMUSE00000355980 Chr11:34129474..34129594 No primer for this exon
downstream ENSMUSE00000396121 Chr11:34128602..34128744 No primer for this exon
downstream ENSMUSE00000580306 Chr11:34126864..34127730 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTTGTAATCGCCTTGCAG Chr11:34408362..34408382 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACCATCCTATTGCAGGTT Chr11:34408423..34408443 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020143