Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20707
Trapped Gene
Ankrd24 (ENSMUSG00000054708)
Vector Insertion
Chr 10: 81109049 - 81109179
Public Clones not available
Private Clones OST354120 (lexicon) OST321074 (lexicon) OST188885 (lexicon) OST165421 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609129 (Chr10:81109050..81109178 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGAAGGTGCAGCAGTCC Chr10:81109090..81109109 61.15 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609129 (Chr10:81109050..81109178 +)
Downstram Exon
ENSMUSE00000609119 (Chr10:81109050..81109178 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGAAGGTGCAGCAGTCC Chr10:81109090..81109109 61.15 60 CACCTTCAGAGCCTCCTTCA Chr10:81109103..81109122 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718684 Chr10:81091380..81091385 No primer for this exon
upstream ENSMUSE00000438711 Chr10:81092292..81092493 AGAGGGTGCAAGTAGCCTGA Chr10:81092311..81092330 60.01 55
upstream ENSMUSE00000709614 Chr10:81092294..81092493 AGAGGGTGCAAGTAGCCTGA Chr10:81092311..81092330 60.01 55
upstream ENSMUSE00000574588 Chr10:81096462..81096500 GAAGCAGCTGTGCCTGTGTG Chr10:81096464..81096483 63.23 60
upstream ENSMUSE00000574587 Chr10:81097412..81097498 No primer for this exon
upstream ENSMUSE00000438699 Chr10:81097610..81097740 GCTGGTGCCTACAAAACTGG Chr10:81097702..81097721 60.69 55
upstream ENSMUSE00000609126 Chr10:81097815..81097903 GGGTGTCTGGAAGTGATGCT Chr10:81097846..81097865 60.12 55
upstream ENSMUSE00000438690 Chr10:81098433..81098497 CACCCAGAGTGTCTGAAGCA Chr10:81098468..81098487 60.02 55
upstream ENSMUSE00000438687 Chr10:81099114..81099171 GTGGTGGACATCGAGGACAG Chr10:81099123..81099142 61.58 60
upstream ENSMUSE00000438681 Chr10:81100814..81100884 TGGTTGTCTGTCCTGCTCAA Chr10:81100821..81100840 60.44 50
upstream ENSMUSE00000297899 Chr10:81101016..81101122 ATAGCGGCTCAGATGTGTCA Chr10:81101037..81101056 59.42 50
upstream ENSMUSE00000297893 Chr10:81101306..81101493 CTCACTACGGAGCCCTGACT Chr10:81101413..81101432 59.47 60
upstream ENSMUSE00000297889 Chr10:81102052..81102089 No primer for this exon
upstream ENSMUSE00000609125 Chr10:81102052..81102681 AGTGACACGAACACCAGCAG Chr10:81102224..81102243 59.94 55
upstream ENSMUSE00000438664 Chr10:81102601..81102681 No primer for this exon
upstream ENSMUSE00000297882 Chr10:81102773..81102880 CGCCTGAGACAAGAGAGAGG Chr10:81102803..81102822 60.28 60
upstream ENSMUSE00000609124 Chr10:81102773..81103557 AGGCTCCCTTTCTCCAACAT Chr10:81103096..81103115 60.07 50
upstream ENSMUSE00000438656 Chr10:81103513..81103557 AGTGCACAGCCTGGAGAGAC Chr10:81103536..81103555 60.62 60
upstream ENSMUSE00000609123 Chr10:81103637..81103735 GGAGAAGCAGGAGGAGAAGG Chr10:81103663..81103682 60.47 60
upstream ENSMUSE00000609133 Chr10:81103637..81103735 GGAGAAGCAGGAGGAGAAGG Chr10:81103663..81103682 60.47 60
upstream ENSMUSE00000609122 Chr10:81104721..81104793 CTACCCTGCAGGATGAGGAG Chr10:81104752..81104771 59.82 60
upstream ENSMUSE00000609132 Chr10:81104721..81104793 CTACCCTGCAGGATGAGGAG Chr10:81104752..81104771 59.82 60
upstream ENSMUSE00000609121 Chr10:81105046..81105164 CTTCCCTACAGGAGCAGGTG Chr10:81105100..81105119 59.86 60
upstream ENSMUSE00000641485 Chr10:81105046..81105164 CTTCCCTACAGGAGCAGGTG Chr10:81105100..81105119 59.86 60
upstream ENSMUSE00000609120 Chr10:81105262..81106638 GTGCAGACCACAGCGATAGA Chr10:81105976..81105995 60.02 55
upstream ENSMUSE00000609130 Chr10:81105262..81106638 GTGCAGACCACAGCGATAGA Chr10:81105976..81105995 60.02 55

*** Putative Vector Insertion (Chr 10: 81109049 - 81109179) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609119 Chr10:81109050..81109178 CACCTTCAGAGCCTCCTTCA Chr10:81109103..81109122 60.52 55
downstream ENSMUSE00000609129 Chr10:81109050..81109178 CACCTTCAGAGCCTCCTTCA Chr10:81109103..81109122 60.52 55
downstream ENSMUSE00000609118 Chr10:81109538..81109603 GGAGATGGGTGCGGTATAAA Chr10:81109592..81109611 59.78 50
downstream ENSMUSE00000609128 Chr10:81109538..81109603 GGAGATGGGTGCGGTATAAA Chr10:81109592..81109611 59.78 50
downstream ENSMUSE00000333720 Chr10:81109845..81110348 GCTGGTCTCCCATTGAGTGT Chr10:81110041..81110060 60.12 55
downstream ENSMUSE00000574586 Chr10:81109845..81110352 GCTGGTCTCCCATTGAGTGT Chr10:81110041..81110060 60.12 55
downstream ENSMUSE00000716587 Chr10:81109845..81110355 GCTGGTCTCCCATTGAGTGT Chr10:81110041..81110060 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGGCTCTGAAGGTAATCG Chr10:81109085..81109106 59.86 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTTTTGCCAGATCACAG Chr10:81109038..81109058 61.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054708