Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20710
Trapped Gene
Pde4a (ENSMUSG00000032177)
Vector Insertion
Chr 9: 21010772 - 21015137
Public Clones CMHD-GT_450B5-3 (cmhd) CMHD-GT_445E9-3 (cmhd)
Private Clones OST354034 (lexicon) OST353122 (lexicon) OST323304 (lexicon) OST314058 (lexicon)
OST287792 (lexicon) OST219869 (lexicon) OST102484 (lexicon) OST15530 (lexicon)
OST13896 (lexicon) OST7120 (lexicon) OST5749 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000584938 (Chr9:21010589..21010771 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGGAGCTGTACCGACAAT Chr9:21010639..21010658 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000584938 (Chr9:21010589..21010771 +)
Downstram Exon
ENSMUSE00000584937 (Chr9:21015138..21016043 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGGAGCTGTACCGACAAT Chr9:21010639..21010658 60.13 55 AGCAGAGATGACGGCAGAAT Chr9:21015755..21015774 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497346 Chr9:20970158..20970676 No primer for this exon
upstream ENSMUSE00000442078 Chr9:20986068..20986264 CTTCCGAGGCAGTGTACAGG Chr9:20986220..20986239 60.84 60
upstream ENSMUSE00000702954 Chr9:20988781..20988995 TCAGCGAGGAGGACACTCTT Chr9:20988950..20988969 60.13 55
upstream ENSMUSE00000295102 Chr9:20995771..20995962 CGCTCAGACAGCGACTATGA Chr9:20995895..20995914 60.31 55
upstream ENSMUSE00000295087 Chr9:20996839..20996875 ACCTCATTGTGACCCCGTTT Chr9:20996850..20996869 61.57 50
upstream ENSMUSE00000584948 Chr9:20996964..20997034 AACGTTCGAAGCAACTTCTCA Chr9:20996982..20997002 60.04 42.86
upstream ENSMUSE00000584947 Chr9:20999019..20999068 No primer for this exon
upstream ENSMUSE00000584946 Chr9:20999190..20999302 ATGCAGACCTACCGCTCTGT Chr9:20999261..20999280 59.9 55
upstream ENSMUSE00000519745 Chr9:21001557..21001622 TTCTTCTGCGAGACCTGCTC Chr9:21001572..21001591 60.82 55
upstream ENSMUSE00000584945 Chr9:21003037..21003130 CACACACCTGTCGGAAATGA Chr9:21003063..21003082 60.57 50
upstream ENSMUSE00000584944 Chr9:21005665..21005861 ACACCGGAAGCTTGAACATC Chr9:21005791..21005810 60.12 50
upstream ENSMUSE00000584943 Chr9:21007642..21007740 AATGGGGCCTGAACATCTTT Chr9:21007661..21007680 60.69 45
upstream ENSMUSE00000584942 Chr9:21007832..21007996 AGGACCACTACCACGCTGAC Chr9:21007899..21007918 60.18 60
upstream ENSMUSE00000584941 Chr9:21008768..21008867 CCTGGAGATTCTTGCTGCTC Chr9:21008782..21008801 60.1 55
upstream ENSMUSE00000584940 Chr9:21009414..21009568 TTCAAGCTGCTGCAAGAAGA Chr9:21009479..21009498 60.01 45
upstream ENSMUSE00000584939 Chr9:21009735..21009857 TGGAGTTCTCTTGCTGGACA Chr9:21009818..21009837 59.54 50
upstream ENSMUSE00000584938 Chr9:21010589..21010771 CCTGGAGCTGTACCGACAAT Chr9:21010639..21010658 60.13 55

*** Putative Vector Insertion (Chr 9: 21010772 - 21015137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584937 Chr9:21015138..21016043 AGCAGAGATGACGGCAGAAT Chr9:21015755..21015774 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAGTAGCTTGGCCCATA Chr9:21013805..21013825 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCCCCATGTGTGACAAG Chr9:21013726..21013746 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032177