Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20711
Trapped Gene
AI662250 (ENSMUSG00000054723)
Vector Insertion
Chr 17: 56855241 - 56856056
Public Clones (sanger)
Private Clones OST353995 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000440978 (Chr17:56856057..56856400 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000440978 (Chr17:56856057..56856400 -)
Downstram Exon
ENSMUSE00000481456 (Chr17:56853361..56855240 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTGCTAGGCACTGATGGAG Chr17:56853814..56853833 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440978 Chr17:56856057..56856400 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56855241 - 56856056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481456 Chr17:56853361..56855240 TGTGCTAGGCACTGATGGAG Chr17:56853814..56853833 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr17:56855986..56856006 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAACGTGACTGGGAAAAC Chr17:56855990..56856010 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGAGGAAAGAAGGGAGCTA Chr17:56856415..56856435 59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGAGGAAAGAAGGGAGCTA Chr17:56856415..56856435 59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054723