Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20719
Trapped Gene
Setdb1 (ENSMUSG00000015697)
Vector Insertion
Chr 3: 95160125 - 95160986
Public Clones (sanger) IST14470A2 (tigm)
Private Clones OST353809 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672294 (Chr3:95160987..95161078 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672294 (Chr3:95160987..95161078 -)
Downstram Exon
ENSMUSE00000717555 (Chr3:95159856..95160124 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672294 Chr3:95160987..95161078 No primer for this exon
upstream ENSMUSE00000672323 Chr3:95160987..95161095 No primer for this exon
upstream ENSMUSE00000374060 Chr3:95160949..95161122 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95160125 - 95160986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252840 Chr3:95159856..95160124 No primer for this exon
downstream ENSMUSE00000717555 Chr3:95159856..95160124 No primer for this exon
downstream ENSMUSE00000176327 Chr3:95158464..95158615 No primer for this exon
downstream ENSMUSE00000176328 Chr3:95153761..95153795 No primer for this exon
downstream ENSMUSE00000176323 Chr3:95151918..95152017 No primer for this exon
downstream ENSMUSE00000176331 Chr3:95150918..95151043 No primer for this exon
downstream ENSMUSE00000176329 Chr3:95150537..95150738 No primer for this exon
downstream ENSMUSE00000176334 Chr3:95149448..95149521 No primer for this exon
downstream ENSMUSE00000176333 Chr3:95145578..95145768 No primer for this exon
downstream ENSMUSE00000252783 Chr3:95145256..95145385 No primer for this exon
downstream ENSMUSE00000176330 Chr3:95144084..95144234 No primer for this exon
downstream ENSMUSE00000176332 Chr3:95143829..95143987 No primer for this exon
downstream ENSMUSE00000672293 Chr3:95143829..95143984 No primer for this exon
downstream ENSMUSE00000176336 Chr3:95142268..95142954 No primer for this exon
downstream ENSMUSE00000365433 Chr3:95141071..95141187 No primer for this exon
downstream ENSMUSE00000252748 Chr3:95132470..95132639 No primer for this exon
downstream ENSMUSE00000252738 Chr3:95131130..95131758 No primer for this exon
downstream ENSMUSE00000176424 Chr3:95130308..95130336 No primer for this exon
downstream ENSMUSE00000176430 Chr3:95130065..95130194 No primer for this exon
downstream ENSMUSE00000176417 Chr3:95129640..95129805 No primer for this exon
downstream ENSMUSE00000176432 Chr3:95128552..95128763 No primer for this exon
downstream ENSMUSE00000176422 Chr3:95128227..95128315 No primer for this exon
downstream ENSMUSE00000705694 Chr3:95127464..95128112 No primer for this exon
downstream ENSMUSE00000334769 Chr3:95127447..95128112 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr3:95160916..95160936 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGTGGGGAGGACGGACT Chr3:95160988..95161008 63.21 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCGTCTCTCCTTCAGTTTGC Chr3:95161087..95161107 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCGTCTCTCCTTCAGTTTGC Chr3:95161087..95161107 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015697