Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20725
Trapped Gene
Lrriq4 (ENSMUSG00000027703)
Vector Insertion
Chr 3: 30549875 - 30554558
Public Clones IST11388H4 (tigm)
Private Clones OST353628 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274098 (Chr3:30548827..30549874 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGCGTCTAACCACCTGAT Chr3:30549506..30549525 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274098 (Chr3:30548827..30549874 +)
Downstram Exon
ENSMUSE00000172455 (Chr3:30554559..30554732 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGCGTCTAACCACCTGAT Chr3:30549506..30549525 60 55 ATTTCCTGTGAGCCCGAGTA Chr3:30554618..30554637 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676165 Chr3:30543429..30543774 CAAGAGCAACAACCAGGACA Chr3:30543716..30543735 59.87 50
upstream ENSMUSE00000639711 Chr3:30544140..30544270 CTGGAGCTTCTCCATCGACT Chr3:30544212..30544231 59.56 55
upstream ENSMUSE00000172454 Chr3:30545175..30545235 TGTTCTTCAGAATGGCCTTG Chr3:30545185..30545204 58.85 45
upstream ENSMUSE00000676162 Chr3:30547148..30547182 No primer for this exon
upstream ENSMUSE00000274098 Chr3:30548827..30549874 GTGGCGTCTAACCACCTGAT Chr3:30549506..30549525 60 55

*** Putative Vector Insertion (Chr 3: 30549875 - 30554558) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000172455 Chr3:30554559..30554732 ATTTCCTGTGAGCCCGAGTA Chr3:30554618..30554637 59.69 50
downstream ENSMUSE00000172449 Chr3:30557976..30558114 GCTGTTCCAGTCGGTTGTTC Chr3:30558021..30558040 60.7 55
downstream ENSMUSE00000172451 Chr3:30558823..30559019 CATGGGGTTGTTCATCAGTG Chr3:30558929..30558948 59.81 50
downstream ENSMUSE00000676164 Chr3:30571063..30571353 GTCCTTTGGAGGGGATTTTC Chr3:30571164..30571183 59.74 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGCTTCCCTTCTGGACTG Chr3:30549878..30549898 59.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATCCTGGCGCTAGATGA Chr3:30549840..30549860 60.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027703