Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20735
Trapped Gene
Itpr3 (ENSMUSG00000042644)
Vector Insertion
Chr 17: 27210114 - 27220474
Public Clones IST14937D4 (tigm)
Private Clones OST353342 (lexicon) OST252901 (lexicon) OST208790 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610378 (Chr17:27210043..27210113 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610378 (Chr17:27210043..27210113 +)
Downstram Exon
ENSMUSE00000610377 (Chr17:27220475..27220596 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGTGCAGAGTAGCGGTTCA Chr17:27220521..27220540 60.2 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610379 Chr17:27194481..27194619 TTCTTCACATCGGGGACATT Chr17:27194550..27194569 60.32 45
upstream ENSMUSE00000610378 Chr17:27210043..27210113 No primer for this exon

*** Putative Vector Insertion (Chr 17: 27210114 - 27220474) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000610377 Chr17:27220475..27220596 CTGTGCAGAGTAGCGGTTCA Chr17:27220521..27220540 60.2 55
downstream ENSMUSE00000610376 Chr17:27222034..27222120 ATCACGCTGCCGTACTTCAC Chr17:27222119..27222138 61.27 55
downstream ENSMUSE00000610375 Chr17:27223784..27223942 CAGCCGCTTGTTCACAGTTA Chr17:27223834..27223853 60.05 50
downstream ENSMUSE00000610374 Chr17:27224091..27224189 TTTGCAGCCAGCATTATCAC Chr17:27224189..27224208 59.84 45
downstream ENSMUSE00000610373 Chr17:27224536..27224619 TGATCTTCCAGCTGGTGTTG Chr17:27224575..27224594 59.83 50
downstream ENSMUSE00000610372 Chr17:27225897..27226043 TTGCCCCTGTACTCATCACA Chr17:27225967..27225986 60.11 50
downstream ENSMUSE00000610371 Chr17:27226207..27226302 TGAACCTGTACAGACCGTTCC Chr17:27226269..27226289 60.02 52.38
downstream ENSMUSE00000610370 Chr17:27226561..27226611 ACCCTTGTAGCTGGGGTTTT Chr17:27226584..27226603 59.86 50
downstream ENSMUSE00000610369 Chr17:27226775..27226917 GCCACCAGACGGTACTTGAT Chr17:27226839..27226858 60 55
downstream ENSMUSE00000610368 Chr17:27228256..27228355 GATCCAGGTGTTGGTGCAGA Chr17:27228304..27228323 62.13 55
downstream ENSMUSE00000610367 Chr17:27228438..27228598 GCCTTCGTTGAGTTTCTCCA Chr17:27228578..27228597 60.38 50
downstream ENSMUSE00000610366 Chr17:27228759..27228900 CTCCAACAGCTGGATGACAA Chr17:27228783..27228802 59.83 50
downstream ENSMUSE00000610365 Chr17:27230120..27230281 GTACTGGTAGGGGGCGTTCT Chr17:27230224..27230243 60.38 60
downstream ENSMUSE00000610364 Chr17:27231740..27231912 AAAGGTCTCCACCTCCGTCT Chr17:27231883..27231902 60.11 55
downstream ENSMUSE00000610363 Chr17:27232409..27232528 CAGGTCGGAGAGGTAGTCCA Chr17:27232436..27232455 60.25 60
downstream ENSMUSE00000610362 Chr17:27232832..27233014 TCGATGCTGAGGTACTCGTG Chr17:27232885..27232904 60.01 55
downstream ENSMUSE00000610361 Chr17:27234907..27235158 CGTGCACATGTAGCATCAGA Chr17:27235076..27235095 59.44 50
downstream ENSMUSE00000610360 Chr17:27235259..27235403 GCTGACCACGTTGTTGAGGT Chr17:27235358..27235377 61.18 55
downstream ENSMUSE00000610359 Chr17:27235919..27236060 CAGCTCGCTGAAGCTGTAGA Chr17:27235978..27235997 59.64 55
downstream ENSMUSE00000610358 Chr17:27236545..27236744 TGTCTAGCTGCTCAGGGACA Chr17:27236676..27236695 59.73 55
downstream ENSMUSE00000610357 Chr17:27238050..27238179 ATGGGAAACACCTCCACAAA Chr17:27238135..27238154 60.21 45
downstream ENSMUSE00000610356 Chr17:27238528..27238585 No primer for this exon
downstream ENSMUSE00000610355 Chr17:27239712..27239877 CGGAGACAAGAGACGGGTAG Chr17:27239815..27239834 59.86 60
downstream ENSMUSE00000610354 Chr17:27240778..27240942 CGGTCCAGCTCTGACTTGAT Chr17:27240845..27240864 60.41 55
downstream ENSMUSE00000610353 Chr17:27241019..27241093 TCTGGTAGTTCTCGCTGCTCT Chr17:27241084..27241104 59.39 52.38
downstream ENSMUSE00000610352 Chr17:27241470..27241595 CTGCAGTAGGTCCAGCATGA Chr17:27241583..27241602 60.01 55
downstream ENSMUSE00000610351 Chr17:27242439..27242561 AGCTGCAAGTGTTTGTGCAG Chr17:27242548..27242567 60.24 50
downstream ENSMUSE00000610350 Chr17:27243151..27243351 CAGCAGGTGCACAAAGTGTT Chr17:27243252..27243271 59.95 50
downstream ENSMUSE00000610349 Chr17:27244175..27244426 CAGAGAGGCCTTGTCGTTGT Chr17:27244231..27244250 60.44 55
downstream ENSMUSE00000610348 Chr17:27244555..27244680 AAGAGCGTCCAGATGTGGTT Chr17:27244655..27244674 59.73 50
downstream ENSMUSE00000610347 Chr17:27244762..27244887 GCTTCTCCCGCTTGTTACAG Chr17:27244786..27244805 60.01 55
downstream ENSMUSE00000610346 Chr17:27247425..27247545 TGGACCACAATTGTCTGGTG Chr17:27247450..27247469 60.42 50
downstream ENSMUSE00000610345 Chr17:27247776..27247966 TAGTCCCACTGGTTGGCAGT Chr17:27247944..27247963 60.57 55
downstream ENSMUSE00000610344 Chr17:27248143..27248291 AGCCTGTACCAGAGGCTTCA Chr17:27248193..27248212 60.01 55
downstream ENSMUSE00000610343 Chr17:27248409..27248517 CAACTTCTCCTCGGACTCCA Chr17:27248457..27248476 60.38 55
downstream ENSMUSE00000610342 Chr17:27248610..27248700 AGACTTGCGGTTCTGGAGAT Chr17:27248666..27248685 58.89 50
downstream ENSMUSE00000610341 Chr17:27248802..27248971 TCTTCTCGTTCTTGGTGCTG Chr17:27248912..27248931 59.16 50
downstream ENSMUSE00000437638 Chr17:27250436..27250610 CAGGTCGCTCATGTTGACAG Chr17:27250564..27250583 60.46 55
downstream ENSMUSE00000388446 Chr17:27250689..27250870 AGGTCACGGTTGTGGTTCTC Chr17:27250869..27250888 60.01 55
downstream ENSMUSE00000549950 Chr17:27251025..27251225 GAACTGCAGGGTCTCACACA Chr17:27251090..27251109 59.87 55
downstream ENSMUSE00000473254 Chr17:27251340..27251450 GGGCTGATGTCATTGAGGAT Chr17:27251413..27251432 59.89 50
downstream ENSMUSE00000332752 Chr17:27251792..27251887 TCACTGTCATGTCGGCTCTC Chr17:27251847..27251866 59.99 55
downstream ENSMUSE00000139631 Chr17:27251973..27252074 GCCTTCTTGATCACGTCCAC Chr17:27251995..27252014 60.67 55
downstream ENSMUSE00000248097 Chr17:27252160..27252246 No primer for this exon
downstream ENSMUSE00000139644 Chr17:27252618..27252728 ACTTGAGCATCTGGGACAGC Chr17:27252660..27252679 60.42 55
downstream ENSMUSE00000367197 Chr17:27252831..27253023 GGTCGAAGAAGTCGCTCACT Chr17:27252978..27252997 59.6 55
downstream ENSMUSE00000248011 Chr17:27253117..27253242 GCGGGAGAACCAGTAGATGA Chr17:27253148..27253167 60.22 55
downstream ENSMUSE00000247991 Chr17:27253554..27253726 TGTAGCGCTTGGTGAACAGT Chr17:27253640..27253659 59.51 50
downstream ENSMUSE00000139700 Chr17:27254111..27254275 GGAACTCCATGTCCATGACC Chr17:27254207..27254226 60.18 55
downstream ENSMUSE00000139712 Chr17:27254678..27254870 AACAGCGTCTCCTCTCGGTA Chr17:27254715..27254734 60.01 55
downstream ENSMUSE00000139612 Chr17:27255302..27255406 CCCACTACATGTGCCCATAA Chr17:27255360..27255379 59.27 50
downstream ENSMUSE00000139648 Chr17:27255490..27255617 TTCCTCAGTCCGTGGTTCAT Chr17:27255577..27255596 60.51 50
downstream ENSMUSE00000549939 Chr17:27256160..27256325 TCACCCCAAAGATGAGGTTC Chr17:27256250..27256269 59.9 50
downstream ENSMUSE00000139676 Chr17:27256813..27256973 TGCTCCAGTTTGATGTGCTC Chr17:27256879..27256898 59.99 50
downstream ENSMUSE00000139708 Chr17:27257876..27258037 AGGATGCGGATCTCATTCTG Chr17:27257967..27257986 60.18 50
downstream ENSMUSE00000438529 Chr17:27258405..27259167 CAAGGTCCACCCTGAGTCAT Chr17:27258990..27259009 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCGAGGTAAGACCTCCAC Chr17:27216108..27216128 59.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCGAGGTAAGACCTCCAC Chr17:27216108..27216128 59.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042644