Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20749
Trapped Gene
Il6ra (ENSMUSG00000027947)
Vector Insertion
Chr 3: 89694396 - 89716876
Public Clones CMHD-GT_379H7-3 (cmhd) (cmhd) IST14176D5 (tigm) IST14176D5 (tigm)
IST10204H3 (tigm)
Private Clones OST353131 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459040 (Chr3:89716877..89717081 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459040 (Chr3:89716877..89717081 -)
Downstram Exon
ENSMUSE00000174578 (Chr3:89694159..89694395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTAACATTGCCTGCTGCTT Chr3:89694288..89694307 60.28 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459040 Chr3:89716877..89717081 No primer for this exon

*** Putative Vector Insertion (Chr 3: 89694396 - 89716876) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174578 Chr3:89694159..89694395 GGTAACATTGCCTGCTGCTT Chr3:89694288..89694307 60.28 50
downstream ENSMUSE00000174586 Chr3:89693109..89693232 CACTCACAGATGGCGTTGAC Chr3:89693144..89693163 60.32 55
downstream ENSMUSE00000174581 Chr3:89690944..89691128 TTGTCACCCTCCAGGATCTC Chr3:89691008..89691027 60.05 55
downstream ENSMUSE00000174580 Chr3:89690464..89690630 GGTATCGAAGCTGGAACTGC Chr3:89690477..89690496 59.84 55
downstream ENSMUSE00000345273 Chr3:89689824..89689965 TGGATGACGCATTGGTACTG Chr3:89689912..89689931 60.54 50
downstream ENSMUSE00000458776 Chr3:89682771..89682817 GTGTGGGGTTCCAGAGGATT Chr3:89682751..89682770 61.15 55
downstream ENSMUSE00000458769 Chr3:89681766..89681835 CGAGGACACTCGTTGCTTCT Chr3:89681744..89681763 60.59 55
downstream ENSMUSE00000458762 Chr3:89680731..89680830 ACATGGACGAGGATTCTTGC Chr3:89680782..89680801 60.08 50
downstream ENSMUSE00000459022 Chr3:89674041..89675308 TCACTCGCGTAAACCATCAG Chr3:89674542..89674561 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGAGGATAAGCTGCCAAA Chr3:89707842..89707862 58.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGAGGATAAGCTGCCAAA Chr3:89707842..89707862 58.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTCTAATCGCCTTGCAGCAC Chr3:89711014..89711034 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGGTCTGCACATACCGTAG Chr3:89711046..89711067 60.58 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027947