Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20752
Trapped Gene
Gla (ENSMUSG00000031266)
Vector Insertion
Chr X: 131128265 - 131129718
Public Clones not available
Private Clones OST353085 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000277094 (ChrX:131129719..131129896 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGGGCGTAGATCTGCTA ChrX:131129765..131129784 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000277094 (ChrX:131129719..131129896 -)
Downstram Exon
ENSMUSE00000207760 (ChrX:131128173..131128264 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGGGCGTAGATCTGCTA ChrX:131129765..131129784 59.86 55 ATACAATGCTTCGGCCTGTC ChrX:131128192..131128211 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352917 ChrX:131135277..131135494 GAGCATTCTTGGGGTCAGAG ChrX:131135380..131135399 59.8 55
upstream ENSMUSE00000207762 ChrX:131130814..131130988 GGATCAAACACCTCGCAAAT ChrX:131130817..131130836 59.94 45
upstream ENSMUSE00000277094 ChrX:131129719..131129896 ACTGGGGCGTAGATCTGCTA ChrX:131129765..131129784 59.86 55

*** Putative Vector Insertion (Chr X: 131128265 - 131129718) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207760 ChrX:131128173..131128264 ATACAATGCTTCGGCCTGTC ChrX:131128192..131128211 60.1 50
downstream ENSMUSE00000207767 ChrX:131126604..131126765 TCCAGCGACTTCAACAATCTC ChrX:131126609..131126629 60.39 47.62
downstream ENSMUSE00000207764 ChrX:131125485..131125682 GCAGAGCTTTGGCTTGAGAG ChrX:131125531..131125550 60.42 55
downstream ENSMUSE00000277059 ChrX:131122895..131124666 TCTCGGGGAGAAGCTGAGTA ChrX:131124473..131124492 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT ChrX:131129648..131129668 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAATCAACGTGACTGGGAAA ChrX:131129654..131129675 59.46 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031266