Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20756
Trapped Gene
Angptl4 (ENSMUSG00000002289)
Vector Insertion
Chr 17: 33917593 - 33917727
Public Clones not available
Private Clones OST352973 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000140709 (Chr17:33917728..33917838 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000140709 (Chr17:33917728..33917838 -)
Downstram Exon
ENSMUSE00000140707 (Chr17:33917475..33917592 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000303846 Chr17:33918008..33918488 No primer for this exon
upstream ENSMUSE00000140709 Chr17:33917728..33917838 No primer for this exon

*** Putative Vector Insertion (Chr 17: 33917593 - 33917727) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140707 Chr17:33917475..33917592 No primer for this exon
downstream ENSMUSE00000140710 Chr17:33915317..33915430 No primer for this exon
downstream ENSMUSE00000140705 Chr17:33914265..33914360 No primer for this exon
downstream ENSMUSE00000140706 Chr17:33913895..33914176 No primer for this exon
downstream ENSMUSE00000303676 Chr17:33911849..33912513 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAAAGAGGAAACAAAGTGG Chr17:33917678..33917699 59.96 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAAAGAGGAAACAAAGTGG Chr17:33917678..33917699 59.96 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002289